ID: 1120415653

View in Genome Browser
Species Human (GRCh38)
Location 14:84215466-84215488
Sequence CACTGAGGCGAGTTCTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120415653_1120415659 27 Left 1120415653 14:84215466-84215488 CCCCAGCAGAACTCGCCTCAGTG No data
Right 1120415659 14:84215516-84215538 CTGTGTCATTCCACCATTGCTGG 0: 3
1: 0
2: 4
3: 20
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120415653 Original CRISPR CACTGAGGCGAGTTCTGCTG GGG (reversed) Intergenic
No off target data available for this crispr