ID: 1120418630

View in Genome Browser
Species Human (GRCh38)
Location 14:84253503-84253525
Sequence CATCACTTATAGATGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120418627_1120418630 7 Left 1120418627 14:84253473-84253495 CCAATGCTTGAAAATCTATGGAA No data
Right 1120418630 14:84253503-84253525 CATCACTTATAGATGGCAGAGGG No data
1120418625_1120418630 16 Left 1120418625 14:84253464-84253486 CCGTTGGCTCCAATGCTTGAAAA No data
Right 1120418630 14:84253503-84253525 CATCACTTATAGATGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120418630 Original CRISPR CATCACTTATAGATGGCAGA GGG Intergenic
No off target data available for this crispr