ID: 1120426061

View in Genome Browser
Species Human (GRCh38)
Location 14:84350241-84350263
Sequence TACATTGCTACTGTAAGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120426061_1120426065 5 Left 1120426061 14:84350241-84350263 CCATCCCTTACAGTAGCAATGTA No data
Right 1120426065 14:84350269-84350291 GAGAGAGAATCTGTGCTTGTGGG No data
1120426061_1120426064 4 Left 1120426061 14:84350241-84350263 CCATCCCTTACAGTAGCAATGTA No data
Right 1120426064 14:84350268-84350290 AGAGAGAGAATCTGTGCTTGTGG No data
1120426061_1120426066 28 Left 1120426061 14:84350241-84350263 CCATCCCTTACAGTAGCAATGTA No data
Right 1120426066 14:84350292-84350314 AGAGAGAGCCGAGTGATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120426061 Original CRISPR TACATTGCTACTGTAAGGGA TGG (reversed) Intergenic