ID: 1120426064

View in Genome Browser
Species Human (GRCh38)
Location 14:84350268-84350290
Sequence AGAGAGAGAATCTGTGCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120426058_1120426064 7 Left 1120426058 14:84350238-84350260 CCCCCATCCCTTACAGTAGCAAT No data
Right 1120426064 14:84350268-84350290 AGAGAGAGAATCTGTGCTTGTGG No data
1120426055_1120426064 21 Left 1120426055 14:84350224-84350246 CCCGTGCCACTAGTCCCCCATCC No data
Right 1120426064 14:84350268-84350290 AGAGAGAGAATCTGTGCTTGTGG No data
1120426061_1120426064 4 Left 1120426061 14:84350241-84350263 CCATCCCTTACAGTAGCAATGTA No data
Right 1120426064 14:84350268-84350290 AGAGAGAGAATCTGTGCTTGTGG No data
1120426059_1120426064 6 Left 1120426059 14:84350239-84350261 CCCCATCCCTTACAGTAGCAATG No data
Right 1120426064 14:84350268-84350290 AGAGAGAGAATCTGTGCTTGTGG No data
1120426056_1120426064 20 Left 1120426056 14:84350225-84350247 CCGTGCCACTAGTCCCCCATCCC No data
Right 1120426064 14:84350268-84350290 AGAGAGAGAATCTGTGCTTGTGG No data
1120426062_1120426064 0 Left 1120426062 14:84350245-84350267 CCCTTACAGTAGCAATGTAGAGC No data
Right 1120426064 14:84350268-84350290 AGAGAGAGAATCTGTGCTTGTGG No data
1120426060_1120426064 5 Left 1120426060 14:84350240-84350262 CCCATCCCTTACAGTAGCAATGT No data
Right 1120426064 14:84350268-84350290 AGAGAGAGAATCTGTGCTTGTGG No data
1120426063_1120426064 -1 Left 1120426063 14:84350246-84350268 CCTTACAGTAGCAATGTAGAGCA No data
Right 1120426064 14:84350268-84350290 AGAGAGAGAATCTGTGCTTGTGG No data
1120426057_1120426064 15 Left 1120426057 14:84350230-84350252 CCACTAGTCCCCCATCCCTTACA No data
Right 1120426064 14:84350268-84350290 AGAGAGAGAATCTGTGCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120426064 Original CRISPR AGAGAGAGAATCTGTGCTTG TGG Intergenic
No off target data available for this crispr