ID: 1120426066

View in Genome Browser
Species Human (GRCh38)
Location 14:84350292-84350314
Sequence AGAGAGAGCCGAGTGATTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120426059_1120426066 30 Left 1120426059 14:84350239-84350261 CCCCATCCCTTACAGTAGCAATG No data
Right 1120426066 14:84350292-84350314 AGAGAGAGCCGAGTGATTGTAGG No data
1120426062_1120426066 24 Left 1120426062 14:84350245-84350267 CCCTTACAGTAGCAATGTAGAGC No data
Right 1120426066 14:84350292-84350314 AGAGAGAGCCGAGTGATTGTAGG No data
1120426063_1120426066 23 Left 1120426063 14:84350246-84350268 CCTTACAGTAGCAATGTAGAGCA No data
Right 1120426066 14:84350292-84350314 AGAGAGAGCCGAGTGATTGTAGG No data
1120426060_1120426066 29 Left 1120426060 14:84350240-84350262 CCCATCCCTTACAGTAGCAATGT No data
Right 1120426066 14:84350292-84350314 AGAGAGAGCCGAGTGATTGTAGG No data
1120426061_1120426066 28 Left 1120426061 14:84350241-84350263 CCATCCCTTACAGTAGCAATGTA No data
Right 1120426066 14:84350292-84350314 AGAGAGAGCCGAGTGATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120426066 Original CRISPR AGAGAGAGCCGAGTGATTGT AGG Intergenic
No off target data available for this crispr