ID: 1120427315

View in Genome Browser
Species Human (GRCh38)
Location 14:84364673-84364695
Sequence CCATATGCAAAATGGGTATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120427309_1120427315 23 Left 1120427309 14:84364627-84364649 CCTGCAGTGCTCAAAGGTCAACC No data
Right 1120427315 14:84364673-84364695 CCATATGCAAAATGGGTATTGGG No data
1120427310_1120427315 2 Left 1120427310 14:84364648-84364670 CCGTATTTGATTAAATCATTCAT No data
Right 1120427315 14:84364673-84364695 CCATATGCAAAATGGGTATTGGG No data
1120427306_1120427315 30 Left 1120427306 14:84364620-84364642 CCTAATCCCTGCAGTGCTCAAAG No data
Right 1120427315 14:84364673-84364695 CCATATGCAAAATGGGTATTGGG No data
1120427308_1120427315 24 Left 1120427308 14:84364626-84364648 CCCTGCAGTGCTCAAAGGTCAAC No data
Right 1120427315 14:84364673-84364695 CCATATGCAAAATGGGTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120427315 Original CRISPR CCATATGCAAAATGGGTATT GGG Intergenic
No off target data available for this crispr