ID: 1120428525

View in Genome Browser
Species Human (GRCh38)
Location 14:84382522-84382544
Sequence TGTTCCTTATCTTAGAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120428525_1120428527 23 Left 1120428525 14:84382522-84382544 CCTTTCTTCTAAGATAAGGAACA No data
Right 1120428527 14:84382568-84382590 ACTTCTATTCAAAATAGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120428525 Original CRISPR TGTTCCTTATCTTAGAAGAA AGG (reversed) Intergenic
No off target data available for this crispr