ID: 1120431327

View in Genome Browser
Species Human (GRCh38)
Location 14:84419369-84419391
Sequence CTGTGCAAGGAGAAAGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120431327_1120431336 22 Left 1120431327 14:84419369-84419391 CCTGCTACTTTCTCCTTGCACAG No data
Right 1120431336 14:84419414-84419436 CTGATCTTGACTAGGGAGATCGG No data
1120431327_1120431334 14 Left 1120431327 14:84419369-84419391 CCTGCTACTTTCTCCTTGCACAG No data
Right 1120431334 14:84419406-84419428 GTTCTAAGCTGATCTTGACTAGG No data
1120431327_1120431337 23 Left 1120431327 14:84419369-84419391 CCTGCTACTTTCTCCTTGCACAG No data
Right 1120431337 14:84419415-84419437 TGATCTTGACTAGGGAGATCGGG No data
1120431327_1120431335 15 Left 1120431327 14:84419369-84419391 CCTGCTACTTTCTCCTTGCACAG No data
Right 1120431335 14:84419407-84419429 TTCTAAGCTGATCTTGACTAGGG No data
1120431327_1120431338 26 Left 1120431327 14:84419369-84419391 CCTGCTACTTTCTCCTTGCACAG No data
Right 1120431338 14:84419418-84419440 TCTTGACTAGGGAGATCGGGTGG No data
1120431327_1120431331 -8 Left 1120431327 14:84419369-84419391 CCTGCTACTTTCTCCTTGCACAG No data
Right 1120431331 14:84419384-84419406 TTGCACAGGAAGGTCCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120431327 Original CRISPR CTGTGCAAGGAGAAAGTAGC AGG (reversed) Intergenic
No off target data available for this crispr