ID: 1120442773

View in Genome Browser
Species Human (GRCh38)
Location 14:84560543-84560565
Sequence CAAGTTAATTGCCCTTATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120442773_1120442776 2 Left 1120442773 14:84560543-84560565 CCCTCATAAGGGCAATTAACTTG No data
Right 1120442776 14:84560568-84560590 TAGTGGAGCACTTGTGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120442773 Original CRISPR CAAGTTAATTGCCCTTATGA GGG (reversed) Intergenic
No off target data available for this crispr