ID: 1120451767

View in Genome Browser
Species Human (GRCh38)
Location 14:84677423-84677445
Sequence CATAATAAGCAGAATGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120451767_1120451769 27 Left 1120451767 14:84677423-84677445 CCAGCATCATTCTGCTTATTATG No data
Right 1120451769 14:84677473-84677495 ACTATAACATAAAACTTCCCTGG No data
1120451767_1120451768 -7 Left 1120451767 14:84677423-84677445 CCAGCATCATTCTGCTTATTATG No data
Right 1120451768 14:84677439-84677461 TATTATGCAGAGATTGAGACTGG No data
1120451767_1120451770 28 Left 1120451767 14:84677423-84677445 CCAGCATCATTCTGCTTATTATG No data
Right 1120451770 14:84677474-84677496 CTATAACATAAAACTTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120451767 Original CRISPR CATAATAAGCAGAATGATGC TGG (reversed) Intergenic
No off target data available for this crispr