ID: 1120452590

View in Genome Browser
Species Human (GRCh38)
Location 14:84687773-84687795
Sequence ACATTTAAGAGCGTGTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120452590_1120452594 -6 Left 1120452590 14:84687773-84687795 CCCCAGCACACGCTCTTAAATGT No data
Right 1120452594 14:84687790-84687812 AAATGTCTTTAACTAGGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120452590 Original CRISPR ACATTTAAGAGCGTGTGCTG GGG (reversed) Intergenic
No off target data available for this crispr