ID: 1120452594

View in Genome Browser
Species Human (GRCh38)
Location 14:84687790-84687812
Sequence AAATGTCTTTAACTAGGATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120452590_1120452594 -6 Left 1120452590 14:84687773-84687795 CCCCAGCACACGCTCTTAAATGT No data
Right 1120452594 14:84687790-84687812 AAATGTCTTTAACTAGGATTAGG No data
1120452592_1120452594 -8 Left 1120452592 14:84687775-84687797 CCAGCACACGCTCTTAAATGTCT No data
Right 1120452594 14:84687790-84687812 AAATGTCTTTAACTAGGATTAGG No data
1120452591_1120452594 -7 Left 1120452591 14:84687774-84687796 CCCAGCACACGCTCTTAAATGTC No data
Right 1120452594 14:84687790-84687812 AAATGTCTTTAACTAGGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120452594 Original CRISPR AAATGTCTTTAACTAGGATT AGG Intergenic
No off target data available for this crispr