ID: 1120453797

View in Genome Browser
Species Human (GRCh38)
Location 14:84705260-84705282
Sequence GATTATATGAGGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120453792_1120453797 -8 Left 1120453792 14:84705245-84705267 CCATTGCCTCTAAGTGATTATAT No data
Right 1120453797 14:84705260-84705282 GATTATATGAGGAAGGTGGAAGG No data
1120453791_1120453797 14 Left 1120453791 14:84705223-84705245 CCAATTATCATATGTGTGAGCTC No data
Right 1120453797 14:84705260-84705282 GATTATATGAGGAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120453797 Original CRISPR GATTATATGAGGAAGGTGGA AGG Intergenic
No off target data available for this crispr