ID: 1120459922

View in Genome Browser
Species Human (GRCh38)
Location 14:84781682-84781704
Sequence TCTTGGCTAAAGCACTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120459922_1120459925 -6 Left 1120459922 14:84781682-84781704 CCTCAAAAGTGCTTTAGCCAAGA No data
Right 1120459925 14:84781699-84781721 CCAAGACAGAGCAAGAAGGAAGG No data
1120459922_1120459923 -10 Left 1120459922 14:84781682-84781704 CCTCAAAAGTGCTTTAGCCAAGA No data
Right 1120459923 14:84781695-84781717 TTAGCCAAGACAGAGCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120459922 Original CRISPR TCTTGGCTAAAGCACTTTTG AGG (reversed) Intergenic
No off target data available for this crispr