ID: 1120462342

View in Genome Browser
Species Human (GRCh38)
Location 14:84813248-84813270
Sequence CTAATTTAGCTTGGGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120462342_1120462347 4 Left 1120462342 14:84813248-84813270 CCTTCCAACCCAAGCTAAATTAG No data
Right 1120462347 14:84813275-84813297 TCTCACCTCTGTCTTCACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120462342 Original CRISPR CTAATTTAGCTTGGGTTGGA AGG (reversed) Intergenic
No off target data available for this crispr