ID: 1120471654

View in Genome Browser
Species Human (GRCh38)
Location 14:84933291-84933313
Sequence TTTCTATTGCTACAAAACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120471652_1120471654 -3 Left 1120471652 14:84933271-84933293 CCTGCAAATAAATGCTTTCCTTT No data
Right 1120471654 14:84933291-84933313 TTTCTATTGCTACAAAACCTTGG No data
1120471651_1120471654 -2 Left 1120471651 14:84933270-84933292 CCCTGCAAATAAATGCTTTCCTT No data
Right 1120471654 14:84933291-84933313 TTTCTATTGCTACAAAACCTTGG No data
1120471650_1120471654 14 Left 1120471650 14:84933254-84933276 CCTTTCTTGCTTGGTGCCCTGCA No data
Right 1120471654 14:84933291-84933313 TTTCTATTGCTACAAAACCTTGG No data
1120471649_1120471654 19 Left 1120471649 14:84933249-84933271 CCTGGCCTTTCTTGCTTGGTGCC No data
Right 1120471654 14:84933291-84933313 TTTCTATTGCTACAAAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120471654 Original CRISPR TTTCTATTGCTACAAAACCT TGG Intergenic
No off target data available for this crispr