ID: 1120472083

View in Genome Browser
Species Human (GRCh38)
Location 14:84938418-84938440
Sequence TACCCAGCAATATTCCCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120472083_1120472084 -7 Left 1120472083 14:84938418-84938440 CCATTTGGGAATATTGCTGGGTA No data
Right 1120472084 14:84938434-84938456 CTGGGTATATCCATCCAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120472083 Original CRISPR TACCCAGCAATATTCCCAAA TGG (reversed) Intergenic
No off target data available for this crispr