ID: 1120474846

View in Genome Browser
Species Human (GRCh38)
Location 14:84974235-84974257
Sequence TAGGCAAGTTTGGGGATGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120474840_1120474846 11 Left 1120474840 14:84974201-84974223 CCAGAGCAGAGTTCTCTTGAGTG No data
Right 1120474846 14:84974235-84974257 TAGGCAAGTTTGGGGATGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120474846 Original CRISPR TAGGCAAGTTTGGGGATGAT TGG Intergenic
No off target data available for this crispr