ID: 1120484419

View in Genome Browser
Species Human (GRCh38)
Location 14:85093455-85093477
Sequence TAGATTTTGTCAGGCAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120484419_1120484426 3 Left 1120484419 14:85093455-85093477 CCACCCCTGCCTGACAAAATCTA No data
Right 1120484426 14:85093481-85093503 GATCCCTTTGGATGATACTATGG No data
1120484419_1120484425 -9 Left 1120484419 14:85093455-85093477 CCACCCCTGCCTGACAAAATCTA No data
Right 1120484425 14:85093469-85093491 CAAAATCTAGTGGATCCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120484419 Original CRISPR TAGATTTTGTCAGGCAGGGG TGG (reversed) Intergenic
No off target data available for this crispr