ID: 1120486140

View in Genome Browser
Species Human (GRCh38)
Location 14:85115285-85115307
Sequence TTCCCACAGAAGTGCATCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120486136_1120486140 29 Left 1120486136 14:85115233-85115255 CCATTATTTGAAGTGGTTGCTTC No data
Right 1120486140 14:85115285-85115307 TTCCCACAGAAGTGCATCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120486140 Original CRISPR TTCCCACAGAAGTGCATCCA AGG Intergenic
No off target data available for this crispr