ID: 1120488547

View in Genome Browser
Species Human (GRCh38)
Location 14:85146945-85146967
Sequence GCTAACCTCTGAACTGCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120488544_1120488547 -4 Left 1120488544 14:85146926-85146948 CCAGTCTGGAATCCCACTGGCTA No data
Right 1120488547 14:85146945-85146967 GCTAACCTCTGAACTGCTAGAGG No data
1120488541_1120488547 20 Left 1120488541 14:85146902-85146924 CCTTGTTTGGCTGCTGGTTGAGA No data
Right 1120488547 14:85146945-85146967 GCTAACCTCTGAACTGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120488547 Original CRISPR GCTAACCTCTGAACTGCTAG AGG Intergenic
No off target data available for this crispr