ID: 1120497503

View in Genome Browser
Species Human (GRCh38)
Location 14:85255153-85255175
Sequence CAATCAAGACTGGTTTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120497499_1120497503 -9 Left 1120497499 14:85255139-85255161 CCCCAGGAAAGTGGCAATCAAGA No data
Right 1120497503 14:85255153-85255175 CAATCAAGACTGGTTTCCCCTGG No data
1120497494_1120497503 20 Left 1120497494 14:85255110-85255132 CCTACCTAGAATTTATAGTTGTG No data
Right 1120497503 14:85255153-85255175 CAATCAAGACTGGTTTCCCCTGG No data
1120497496_1120497503 16 Left 1120497496 14:85255114-85255136 CCTAGAATTTATAGTTGTGAGGA No data
Right 1120497503 14:85255153-85255175 CAATCAAGACTGGTTTCCCCTGG No data
1120497500_1120497503 -10 Left 1120497500 14:85255140-85255162 CCCAGGAAAGTGGCAATCAAGAC No data
Right 1120497503 14:85255153-85255175 CAATCAAGACTGGTTTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120497503 Original CRISPR CAATCAAGACTGGTTTCCCC TGG Intergenic