ID: 1120502621

View in Genome Browser
Species Human (GRCh38)
Location 14:85315722-85315744
Sequence CTGGATCTCCATGGTTTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120502621_1120502625 19 Left 1120502621 14:85315722-85315744 CCATTCAAACCATGGAGATCCAG No data
Right 1120502625 14:85315764-85315786 TATAGGAATTTGTGTAAATTAGG No data
1120502621_1120502624 2 Left 1120502621 14:85315722-85315744 CCATTCAAACCATGGAGATCCAG No data
Right 1120502624 14:85315747-85315769 TCTCACTAAAGAATGTGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120502621 Original CRISPR CTGGATCTCCATGGTTTGAA TGG (reversed) Intergenic
No off target data available for this crispr