ID: 1120504404

View in Genome Browser
Species Human (GRCh38)
Location 14:85336850-85336872
Sequence CCCTGAACTGTTTAATGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120504398_1120504404 27 Left 1120504398 14:85336800-85336822 CCACCTTGTTTGTTATGCCAAAT No data
Right 1120504404 14:85336850-85336872 CCCTGAACTGTTTAATGAGCTGG No data
1120504400_1120504404 10 Left 1120504400 14:85336817-85336839 CCAAATACGTCACTGTCTTTTCC No data
Right 1120504404 14:85336850-85336872 CCCTGAACTGTTTAATGAGCTGG No data
1120504399_1120504404 24 Left 1120504399 14:85336803-85336825 CCTTGTTTGTTATGCCAAATACG No data
Right 1120504404 14:85336850-85336872 CCCTGAACTGTTTAATGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120504404 Original CRISPR CCCTGAACTGTTTAATGAGC TGG Intergenic
No off target data available for this crispr