ID: 1120509998

View in Genome Browser
Species Human (GRCh38)
Location 14:85401695-85401717
Sequence CTTTCCAGCTAGAAGCCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120509995_1120509998 -8 Left 1120509995 14:85401680-85401702 CCAAAATCTGAAGGCCTTTCCAG No data
Right 1120509998 14:85401695-85401717 CTTTCCAGCTAGAAGCCTCAGGG No data
1120509992_1120509998 24 Left 1120509992 14:85401648-85401670 CCAAACAAAACAGCCAGCTGTGT No data
Right 1120509998 14:85401695-85401717 CTTTCCAGCTAGAAGCCTCAGGG No data
1120509993_1120509998 11 Left 1120509993 14:85401661-85401683 CCAGCTGTGTCAGTGTCATCCAA No data
Right 1120509998 14:85401695-85401717 CTTTCCAGCTAGAAGCCTCAGGG No data
1120509991_1120509998 27 Left 1120509991 14:85401645-85401667 CCACCAAACAAAACAGCCAGCTG No data
Right 1120509998 14:85401695-85401717 CTTTCCAGCTAGAAGCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120509998 Original CRISPR CTTTCCAGCTAGAAGCCTCA GGG Intergenic
No off target data available for this crispr