ID: 1120510517

View in Genome Browser
Species Human (GRCh38)
Location 14:85408186-85408208
Sequence ACATCTCCATTCTCACCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120510517_1120510522 22 Left 1120510517 14:85408186-85408208 CCTCAGGGTGAGAATGGAGATGT No data
Right 1120510522 14:85408231-85408253 ATGTTATTCTAGAGGAAAAATGG No data
1120510517_1120510520 14 Left 1120510517 14:85408186-85408208 CCTCAGGGTGAGAATGGAGATGT No data
Right 1120510520 14:85408223-85408245 TCCTAATCATGTTATTCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120510517 Original CRISPR ACATCTCCATTCTCACCCTG AGG (reversed) Intergenic
No off target data available for this crispr