ID: 1120510519

View in Genome Browser
Species Human (GRCh38)
Location 14:85408217-85408239
Sequence GAATAACATGATTAGGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120510519_1120510522 -9 Left 1120510519 14:85408217-85408239 CCATATTCCTAATCATGTTATTC No data
Right 1120510522 14:85408231-85408253 ATGTTATTCTAGAGGAAAAATGG No data
1120510519_1120510527 17 Left 1120510519 14:85408217-85408239 CCATATTCCTAATCATGTTATTC No data
Right 1120510527 14:85408257-85408279 CCATGGGATATAACAGGTTTAGG No data
1120510519_1120510524 1 Left 1120510519 14:85408217-85408239 CCATATTCCTAATCATGTTATTC No data
Right 1120510524 14:85408241-85408263 AGAGGAAAAATGGTATCCATGGG No data
1120510519_1120510523 0 Left 1120510519 14:85408217-85408239 CCATATTCCTAATCATGTTATTC No data
Right 1120510523 14:85408240-85408262 TAGAGGAAAAATGGTATCCATGG No data
1120510519_1120510525 11 Left 1120510519 14:85408217-85408239 CCATATTCCTAATCATGTTATTC No data
Right 1120510525 14:85408251-85408273 TGGTATCCATGGGATATAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120510519 Original CRISPR GAATAACATGATTAGGAATA TGG (reversed) Intergenic
No off target data available for this crispr