ID: 1120510522

View in Genome Browser
Species Human (GRCh38)
Location 14:85408231-85408253
Sequence ATGTTATTCTAGAGGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120510519_1120510522 -9 Left 1120510519 14:85408217-85408239 CCATATTCCTAATCATGTTATTC No data
Right 1120510522 14:85408231-85408253 ATGTTATTCTAGAGGAAAAATGG No data
1120510517_1120510522 22 Left 1120510517 14:85408186-85408208 CCTCAGGGTGAGAATGGAGATGT No data
Right 1120510522 14:85408231-85408253 ATGTTATTCTAGAGGAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120510522 Original CRISPR ATGTTATTCTAGAGGAAAAA TGG Intergenic
No off target data available for this crispr