ID: 1120510524 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:85408241-85408263 |
Sequence | AGAGGAAAAATGGTATCCAT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1120510519_1120510524 | 1 | Left | 1120510519 | 14:85408217-85408239 | CCATATTCCTAATCATGTTATTC | No data | ||
Right | 1120510524 | 14:85408241-85408263 | AGAGGAAAAATGGTATCCATGGG | No data | ||||
1120510521_1120510524 | -6 | Left | 1120510521 | 14:85408224-85408246 | CCTAATCATGTTATTCTAGAGGA | No data | ||
Right | 1120510524 | 14:85408241-85408263 | AGAGGAAAAATGGTATCCATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1120510524 | Original CRISPR | AGAGGAAAAATGGTATCCAT GGG | Intergenic | ||
No off target data available for this crispr |