ID: 1120510524

View in Genome Browser
Species Human (GRCh38)
Location 14:85408241-85408263
Sequence AGAGGAAAAATGGTATCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120510519_1120510524 1 Left 1120510519 14:85408217-85408239 CCATATTCCTAATCATGTTATTC No data
Right 1120510524 14:85408241-85408263 AGAGGAAAAATGGTATCCATGGG No data
1120510521_1120510524 -6 Left 1120510521 14:85408224-85408246 CCTAATCATGTTATTCTAGAGGA No data
Right 1120510524 14:85408241-85408263 AGAGGAAAAATGGTATCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120510524 Original CRISPR AGAGGAAAAATGGTATCCAT GGG Intergenic
No off target data available for this crispr