ID: 1120513037

View in Genome Browser
Species Human (GRCh38)
Location 14:85438482-85438504
Sequence GTGTCTGAGAAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120513029_1120513037 10 Left 1120513029 14:85438449-85438471 CCAGTTGGTCAGGATTTCTGGAG No data
Right 1120513037 14:85438482-85438504 GTGTCTGAGAAGAAGGAGGAGGG No data
1120513024_1120513037 23 Left 1120513024 14:85438436-85438458 CCCCAACTGGAAGCCAGTTGGTC 0: 3
1: 23
2: 50
3: 107
4: 270
Right 1120513037 14:85438482-85438504 GTGTCTGAGAAGAAGGAGGAGGG No data
1120513025_1120513037 22 Left 1120513025 14:85438437-85438459 CCCAACTGGAAGCCAGTTGGTCA 0: 3
1: 22
2: 58
3: 138
4: 394
Right 1120513037 14:85438482-85438504 GTGTCTGAGAAGAAGGAGGAGGG No data
1120513026_1120513037 21 Left 1120513026 14:85438438-85438460 CCAACTGGAAGCCAGTTGGTCAG No data
Right 1120513037 14:85438482-85438504 GTGTCTGAGAAGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120513037 Original CRISPR GTGTCTGAGAAGAAGGAGGA GGG Intergenic
No off target data available for this crispr