ID: 1120514331

View in Genome Browser
Species Human (GRCh38)
Location 14:85452400-85452422
Sequence CCTTATCTGCAGAATGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120514320_1120514331 18 Left 1120514320 14:85452359-85452381 CCTTTTCTGCTTATTTACTATAC No data
Right 1120514331 14:85452400-85452422 CCTTATCTGCAGAATGGGGGTGG No data
1120514319_1120514331 19 Left 1120514319 14:85452358-85452380 CCCTTTTCTGCTTATTTACTATA No data
Right 1120514331 14:85452400-85452422 CCTTATCTGCAGAATGGGGGTGG No data
1120514323_1120514331 -4 Left 1120514323 14:85452381-85452403 CCTGTCTGGGCCTCAGTTCCCTT No data
Right 1120514331 14:85452400-85452422 CCTTATCTGCAGAATGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120514331 Original CRISPR CCTTATCTGCAGAATGGGGG TGG Intergenic
No off target data available for this crispr