ID: 1120515447

View in Genome Browser
Species Human (GRCh38)
Location 14:85464834-85464856
Sequence CTGAGGCTAAGCAGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120515447_1120515453 7 Left 1120515447 14:85464834-85464856 CCCACTTCCCTGCTTAGCCTCAG No data
Right 1120515453 14:85464864-85464886 TTGTCACATCCGGACCTCTATGG No data
1120515447_1120515457 29 Left 1120515447 14:85464834-85464856 CCCACTTCCCTGCTTAGCCTCAG No data
Right 1120515457 14:85464886-85464908 GCTCTGACCAGCTATCAAAAGGG No data
1120515447_1120515456 28 Left 1120515447 14:85464834-85464856 CCCACTTCCCTGCTTAGCCTCAG No data
Right 1120515456 14:85464885-85464907 GGCTCTGACCAGCTATCAAAAGG No data
1120515447_1120515452 -3 Left 1120515447 14:85464834-85464856 CCCACTTCCCTGCTTAGCCTCAG No data
Right 1120515452 14:85464854-85464876 CAGATGCTGCTTGTCACATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120515447 Original CRISPR CTGAGGCTAAGCAGGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr