ID: 1120515468

View in Genome Browser
Species Human (GRCh38)
Location 14:85464969-85464991
Sequence ATGTGCTAGTTTAAGTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120515465_1120515468 12 Left 1120515465 14:85464934-85464956 CCAGAAGGTGCAAGCTTTAGGAC No data
Right 1120515468 14:85464969-85464991 ATGTGCTAGTTTAAGTCTGCAGG No data
1120515463_1120515468 20 Left 1120515463 14:85464926-85464948 CCACTGCTCCAGAAGGTGCAAGC No data
Right 1120515468 14:85464969-85464991 ATGTGCTAGTTTAAGTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120515468 Original CRISPR ATGTGCTAGTTTAAGTCTGC AGG Intergenic
No off target data available for this crispr