ID: 1120517092

View in Genome Browser
Species Human (GRCh38)
Location 14:85483639-85483661
Sequence GACTGAATTGATTTTAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120517087_1120517092 -2 Left 1120517087 14:85483618-85483640 CCTGAAGCCATAGAGGACTGAGA No data
Right 1120517092 14:85483639-85483661 GACTGAATTGATTTTAGGTGGGG No data
1120517088_1120517092 -9 Left 1120517088 14:85483625-85483647 CCATAGAGGACTGAGACTGAATT No data
Right 1120517092 14:85483639-85483661 GACTGAATTGATTTTAGGTGGGG No data
1120517083_1120517092 30 Left 1120517083 14:85483586-85483608 CCAGGAAGCTGTCCCTATTATCA No data
Right 1120517092 14:85483639-85483661 GACTGAATTGATTTTAGGTGGGG No data
1120517085_1120517092 17 Left 1120517085 14:85483599-85483621 CCTATTATCAAAATTAGAGCCTG No data
Right 1120517092 14:85483639-85483661 GACTGAATTGATTTTAGGTGGGG No data
1120517084_1120517092 18 Left 1120517084 14:85483598-85483620 CCCTATTATCAAAATTAGAGCCT No data
Right 1120517092 14:85483639-85483661 GACTGAATTGATTTTAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120517092 Original CRISPR GACTGAATTGATTTTAGGTG GGG Intergenic