ID: 1120523315

View in Genome Browser
Species Human (GRCh38)
Location 14:85549284-85549306
Sequence CAGGGCCTCTGGGACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 745
Summary {0: 1, 1: 0, 2: 5, 3: 76, 4: 663}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120523306_1120523315 17 Left 1120523306 14:85549244-85549266 CCATCCATGGATGGCAAAACTAA 0: 4
1: 17
2: 47
3: 126
4: 355
Right 1120523315 14:85549284-85549306 CAGGGCCTCTGGGACTCTGGGGG 0: 1
1: 0
2: 5
3: 76
4: 663
1120523307_1120523315 13 Left 1120523307 14:85549248-85549270 CCATGGATGGCAAAACTAAAAGA 0: 3
1: 31
2: 68
3: 127
4: 401
Right 1120523315 14:85549284-85549306 CAGGGCCTCTGGGACTCTGGGGG 0: 1
1: 0
2: 5
3: 76
4: 663

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120523315 Original CRISPR CAGGGCCTCTGGGACTCTGG GGG Intronic
900189067 1:1345695-1345717 TGTGGCCTCTGGGAGTCTGGAGG - Intronic
900545209 1:3224911-3224933 CAGCATCTCAGGGACTCTGGCGG + Intronic
900628367 1:3620372-3620394 CAAGGCCTCTGGGCCTGTGATGG - Intergenic
900946380 1:5833524-5833546 CAGGGCATTTGGGGCTCTGCGGG - Intergenic
901154325 1:7125347-7125369 CATGGCATCTGGGACACAGGAGG - Intronic
901234232 1:7659030-7659052 CAGGGGGCCTGGGATTCTGGTGG - Intronic
901327764 1:8379209-8379231 CAGGCCCACAGAGACTCTGGAGG - Intronic
901464672 1:9413574-9413596 CTGGGCCCCTGGGAATCTGTTGG - Intergenic
901966111 1:12868013-12868035 CAGGGCCTCTCGGGGTGTGGAGG - Intronic
901981502 1:13038266-13038288 CAGGGCCTCTCGGGGTGTGGAGG - Intronic
902000580 1:13190647-13190669 CAGGGCCTCTCGGGGTGTGGAGG + Intergenic
902019824 1:13336414-13336436 CAGGGCCTCTCGGGGTGTGGAGG + Intergenic
902271193 1:15306517-15306539 CTGGGCCTCTGGGCCTGTGATGG - Intronic
902278559 1:15357689-15357711 CAGGGCCGCTGGAGCCCTGGAGG + Intronic
902323346 1:15683645-15683667 CAGTGCCTCGGGGTCTTTGGGGG + Intergenic
902821674 1:18947268-18947290 GAGGGCCTCGGGCATTCTGGTGG - Intronic
902924816 1:19689107-19689129 CAGGTCCTGTGGGTCTCTGTTGG + Intronic
903132408 1:21288976-21288998 CTGGGCCTATGTGACCCTGGAGG + Intronic
903233585 1:21936236-21936258 CAGGTCCTCAGGGCCTCTGCTGG + Intronic
903331830 1:22600519-22600541 CAGGTGCTCTGGGACGGTGGGGG + Intronic
903374854 1:22859374-22859396 CAGGGCCCCTGGGCCCCAGGGGG - Intronic
903597074 1:24503000-24503022 CGGGGCCTCTGGGAGCCTGGTGG - Exonic
904203695 1:28838584-28838606 CAGGGGCCCTGGGACTCCAGGGG + Intronic
904356694 1:29944914-29944936 AAGACCCTCTGAGACTCTGGGGG + Intergenic
904386209 1:30143723-30143745 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
904533151 1:31182136-31182158 ATGGGCCTCTGGGGGTCTGGAGG + Intronic
904572088 1:31473691-31473713 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
904597036 1:31653423-31653445 CAGGGCCTGTGGGGATGTGGGGG - Intronic
905224124 1:36468034-36468056 CAGGCCTTCTGGGGCTGTGGGGG + Intronic
905785625 1:40754791-40754813 CAGTGCTTCTGGGTCTCTCGGGG + Intronic
906142488 1:43542091-43542113 CTGGGACCCTGGGACTCTGGGGG + Intronic
906184590 1:43851806-43851828 CAGCGGGTCTGGGACTCTGGTGG - Intronic
906264275 1:44417017-44417039 CAAGGGCTCTGGGACTGGGGTGG + Intronic
906293561 1:44635470-44635492 CAGCTCCACTGGGACCCTGGGGG + Intronic
906615944 1:47232721-47232743 CTGGGTGTCTGGGACACTGGAGG - Intergenic
907247921 1:53119976-53119998 AAGAGCCTCTGGGAGTCTGGAGG + Intronic
907307137 1:53519726-53519748 CAGAGCCCCTGGGACTCTGCGGG - Intronic
908210487 1:61895358-61895380 CTAGGCCTCTGGGACTGTGATGG - Intronic
910123894 1:83819522-83819544 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
910149588 1:84126110-84126132 CATGCCCTCTAGGACTCCGGAGG - Intronic
911102449 1:94105400-94105422 CAGGGCTGCTGTGGCTCTGGGGG + Intronic
911127910 1:94358428-94358450 CAGGGCCCCTGGATCTCTGAAGG - Intergenic
912263623 1:108132598-108132620 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
912267554 1:108174181-108174203 CTGGGCCTCTGGGCCTATGATGG - Intronic
912510214 1:110184621-110184643 CAGGAGCTCTGGGACTCTGTGGG + Intronic
915000347 1:152583843-152583865 CAGGGCATCTGGGACTCTCTGGG + Intronic
915294574 1:154911000-154911022 GAGGGCCCCTGGAACCCTGGAGG + Intergenic
915516578 1:156416300-156416322 AGGGGCCTGTGTGACTCTGGTGG + Intronic
915538239 1:156550595-156550617 CAGAGCCTCTGTGGTTCTGGAGG - Intronic
917123485 1:171665007-171665029 GAGAGCCTCTGGGAGGCTGGGGG - Intergenic
918078401 1:181187999-181188021 CAGAGATTCTGGCACTCTGGAGG + Intergenic
918119835 1:181529045-181529067 CTGGGCCTCTGGGCCTGTGATGG - Intronic
919200364 1:194348700-194348722 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
920074762 1:203327855-203327877 CAAAGCCTGAGGGACTCTGGAGG - Intergenic
920305473 1:205015576-205015598 CAGGGCCTATGGGCCTCAGAAGG + Intronic
920799579 1:209173970-209173992 CAGGGCCTCTAGCCCTGTGGTGG - Intergenic
921000540 1:211039028-211039050 CTGGGCCTCTGGGCCTATGATGG - Intronic
922337268 1:224627891-224627913 AATGGCCTCTGAGACTCAGGTGG - Intronic
922504345 1:226117993-226118015 GCAGGCCTTTGGGACTCTGGAGG - Intergenic
922844972 1:228677527-228677549 CAGGGCCTCAGCGATTTTGGAGG + Intergenic
923038355 1:230301200-230301222 CAGGGCCACTGAGCCTCTGCAGG - Intergenic
923627388 1:235625086-235625108 AAGGGGCTCTGGGGCTCTGGGGG + Intronic
923663906 1:235982089-235982111 CAGGTCCTATGGGAGCCTGGAGG + Intronic
1062916192 10:1242619-1242641 CAGGGGACCTGGGACTCAGGTGG - Intronic
1063168453 10:3484863-3484885 CACGGCCTCTGGGAGAGTGGAGG - Intergenic
1063309748 10:4941009-4941031 CAGGGGCTTGGGGTCTCTGGGGG + Intronic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1065122712 10:22544371-22544393 CAAGGCCTCTGGGCTGCTGGAGG + Intronic
1065351844 10:24802808-24802830 CATGCCCTCTGGGGCTCTGGTGG + Intergenic
1065963104 10:30750268-30750290 TGGGGGCTCTGGGGCTCTGGGGG - Intergenic
1065989418 10:30993263-30993285 CTAGGCCTCTGGGCCTCTGATGG - Intronic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1067814653 10:49464581-49464603 CTGGGCCTCTGGGCCTGTGATGG - Intronic
1068344397 10:55754708-55754730 TGGGGCCTCTGGGAAGCTGGAGG + Intergenic
1068552989 10:58426692-58426714 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
1069708856 10:70476496-70476518 CAGGCCCTCTGGGGGGCTGGTGG + Intergenic
1069804096 10:71107139-71107161 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
1070736522 10:78867073-78867095 CAGTGCCCCTTGGTCTCTGGAGG + Intergenic
1071442914 10:85718734-85718756 CTGGGCCTCTGGGCCTGTGATGG + Intronic
1071485560 10:86099854-86099876 CAGGGCCTCTGGAACACTGAGGG - Intronic
1072107892 10:92291308-92291330 CAGGGCCTGCGGGAGTCCGGCGG - Exonic
1072430611 10:95367821-95367843 CAGGACCTCTGGAAGTCAGGGGG + Intronic
1072488064 10:95874998-95875020 CTGGGCCTCTGGGCCTGTGATGG + Exonic
1073431833 10:103492233-103492255 CTGGGCATCTGGGAGGCTGGAGG + Intergenic
1074441046 10:113477678-113477700 AAAGGCCTTTGGGACTGTGGTGG - Intergenic
1074776672 10:116772310-116772332 TTGGGGCTCTGGGGCTCTGGGGG - Intergenic
1074836761 10:117303623-117303645 CTGGGCCTCTGGGCCTGTGATGG - Intronic
1075342949 10:121661768-121661790 AAGGGGTTCTGGGACTCTGGAGG + Intergenic
1075687282 10:124373134-124373156 CAGCTCCTCTAGGATTCTGGTGG + Intergenic
1075845527 10:125542342-125542364 TGGGGCTTCTGGGACTCTTGGGG - Intergenic
1076034016 10:127184028-127184050 CAGTGTCTCTGGTAATCTGGAGG + Intronic
1076590102 10:131577003-131577025 CAGGGCCTGGGGGTCTCTGCTGG - Intergenic
1076760131 10:132599994-132600016 CTGGGCCTCTGGGCCTGTGGTGG + Intronic
1076808941 10:132876662-132876684 GAGGGCCTGTGGGAGGCTGGGGG + Intronic
1077028443 11:452047-452069 CAGGACCTCAGAGACTCCGGTGG - Intronic
1077253062 11:1569117-1569139 CAGGGCCACAGGTACTCAGGAGG - Intronic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1077736872 11:4800492-4800514 CTGGGCCTCTAGGCCTGTGGTGG + Intronic
1078551177 11:12281447-12281469 CAGGGGCTATGGGATGCTGGAGG - Intronic
1078712993 11:13813156-13813178 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
1079341091 11:19612240-19612262 CTGGGCCTCTGGGCCTGTGATGG + Intronic
1080604357 11:33852613-33852635 CATGCCCTCTGGGGCTTTGGGGG - Intergenic
1081479954 11:43476749-43476771 CTGGGCCTCTGGGCCTGTGATGG + Intronic
1081676579 11:44973571-44973593 CAGGGCCTCCGCTTCTCTGGAGG - Intergenic
1081725089 11:45322422-45322444 GAGGGACTCTGGGACCCTGTTGG - Intergenic
1081939389 11:46928099-46928121 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
1082554801 11:54551453-54551475 CAGGGCTTTGGGGACTCTGTTGG + Intergenic
1083305640 11:61760834-61760856 CCAGGCCTCTTTGACTCTGGAGG + Intronic
1083771778 11:64871560-64871582 CAAGGCCTCTAGGGCTATGGAGG + Intronic
1084105447 11:66977382-66977404 CAGGGCCCCTGGGGCTCTCCAGG + Intergenic
1084200161 11:67551740-67551762 CTAGGCCTCTGGGCCTGTGGTGG - Intergenic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084309704 11:68309792-68309814 GAGGGCCTCTTGGACTCAAGTGG - Intergenic
1084412909 11:69014342-69014364 GAGGGACTCTGGGATCCTGGAGG + Intergenic
1084811532 11:71614761-71614783 AAGGGCCTATTGGACTCTGGGGG + Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1085194375 11:74659329-74659351 CTGGGCCTCTGGGCCTGTGATGG + Intronic
1086231674 11:84577860-84577882 CTGGGCCTCTGGGCCTGTGATGG - Intronic
1086995785 11:93353862-93353884 CTGGGCCTCTGGGCCTGTGATGG + Intronic
1087005545 11:93467204-93467226 CATGCCCTCTGGGGCTTTGGGGG + Intergenic
1088108384 11:106230581-106230603 CAGGGCCTCTTTGCCTCTGTTGG - Intergenic
1088567090 11:111183899-111183921 CTAGGCCTCTGGGCCTCTGATGG - Intergenic
1088611241 11:111579201-111579223 TAGAGCCTGTGGGACTCAGGAGG - Intergenic
1088751344 11:112844650-112844672 GATGACCTCTGTGACTCTGGTGG + Intergenic
1089613180 11:119681013-119681035 GAGGACCACTGGGACTCGGGAGG - Intronic
1089806241 11:121093415-121093437 CAGCTCCTCTAGGGCTCTGGTGG + Intergenic
1090727425 11:129540245-129540267 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
1091006017 11:131954404-131954426 CAGGGACTCTGGCTCTCTGAAGG + Intronic
1091224298 11:133948497-133948519 GAGGGCCCCTGGGGCTGTGGGGG - Intronic
1091541288 12:1465037-1465059 CAGGAGCTCAGGGACTCAGGAGG - Intronic
1092093652 12:5824088-5824110 CTGGGCCTCTGGGTCTGTGATGG + Intronic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092631348 12:10381146-10381168 GAGTGGCTCTGGGAATCTGGGGG - Intronic
1092933556 12:13339587-13339609 GCAGGCCTCTGGGACTCTTGTGG + Intergenic
1093564642 12:20588309-20588331 AAGGCCCTCTGGGTCTCTGAAGG - Intronic
1093641045 12:21527526-21527548 CAGGGGCCCTGGAGCTCTGGAGG - Intronic
1094132510 12:27089617-27089639 CAGGGAGTCCTGGACTCTGGAGG - Intergenic
1094181986 12:27601624-27601646 CAGGGAGTCCTGGACTCTGGAGG - Intronic
1095308148 12:40662472-40662494 CAAGGCCTCTGGGCCTGTGATGG - Intergenic
1095349309 12:41189531-41189553 CAGGGCCGCGGGGATGCTGGTGG - Intronic
1095387263 12:41665690-41665712 CAGGGCCTGTGGGAGGATGGGGG + Intergenic
1096101060 12:48970714-48970736 CAGGGACTCTGGGAATCAAGGGG - Intronic
1096186441 12:49584764-49584786 CAGAGCCCCTGGGACTTGGGAGG - Intronic
1096509006 12:52116856-52116878 AACGGCCTATGGAACTCTGGGGG - Intergenic
1096622821 12:52874921-52874943 CAGGGGCCCTGGCACTGTGGAGG - Intergenic
1097269621 12:57765970-57765992 CAGGGCGTCTGGGCTTCTGGGGG + Intronic
1097360530 12:58654306-58654328 CTGGGCCTCTGGGCCTATGGTGG + Intronic
1097570574 12:61326337-61326359 CTGGGCCTCTGGGCCTTTGATGG + Intergenic
1098253150 12:68589867-68589889 CTAGGCCTCTGGGACTGTGATGG - Intergenic
1098493576 12:71110045-71110067 CATGCCCTCTGGGGCTCTAGAGG - Intronic
1098545576 12:71707638-71707660 CATGCCCTCTGGGGCTCTGGGGG - Intergenic
1099396469 12:82146896-82146918 TAGGGCCTCTGGGTCTGTGATGG - Intergenic
1099490724 12:83284832-83284854 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
1099700442 12:86075852-86075874 CTGGGCCTCTGGGCCTGTGGTGG + Intronic
1099707819 12:86179992-86180014 CTGGGCCTCTGGGCCTGTGATGG - Intronic
1099846211 12:88031383-88031405 CTGGGCCTCTGGGCCTGTGATGG + Intronic
1100757906 12:97772796-97772818 CATGCCCTCTGGGGCTTTGGGGG - Intergenic
1102148677 12:110673577-110673599 CTGGGCCTCTGGGTCTGTGATGG - Intronic
1102218835 12:111180639-111180661 AAGGGCCTCTGAGGATCTGGTGG + Intronic
1102305297 12:111800114-111800136 CAGGGCCTACTGGAATCTGGTGG + Intronic
1102566430 12:113800357-113800379 CAGCACCACTGGGACTCTGACGG - Intergenic
1103274195 12:119697838-119697860 CTGGAACTCTGGGACTCTGCAGG - Exonic
1103378707 12:120477294-120477316 CATGGCATCTGGGACTTTGGTGG + Intronic
1103380479 12:120490417-120490439 CAAGGCCTCTGTGACTCAGTAGG - Intronic
1103481004 12:121249640-121249662 CAGGGCCTCTGAGCTGCTGGGGG - Intronic
1103941059 12:124501469-124501491 CAGGGCCCCACGGCCTCTGGGGG + Intronic
1104004768 12:124884270-124884292 GAGGGCCTGAGGGATTCTGGCGG + Intergenic
1104079894 12:125420557-125420579 CTGGGCTTCTGGGCCTCTGATGG + Intronic
1104676500 12:130715259-130715281 CGTGGCCTCTGGGTCCCTGGAGG - Intronic
1104730393 12:131102529-131102551 CAGGGCACCTGGGACGCTGTGGG - Intronic
1104746910 12:131216292-131216314 CAGGGACCCTGGGGCTCTGCAGG - Intergenic
1104785709 12:131446891-131446913 CAGGGACCCTGGGGCTCTGCAGG + Intergenic
1105245979 13:18650644-18650666 CATGCCCTCTGGGGCTCTGGGGG - Intergenic
1105528944 13:21200789-21200811 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
1106262347 13:28078553-28078575 CTGGGCCTCTGGGCCTGTGATGG + Intronic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1108527749 13:51300274-51300296 CTGGGTGTCTGGGACTCTGGAGG - Intergenic
1108768347 13:53663316-53663338 CAAGGCCTCTGGGCCTGTGATGG - Intergenic
1110509524 13:76333081-76333103 CAGGGCCTCTGGGAATATCAGGG - Intergenic
1111341564 13:86892549-86892571 CAGGAGCTCTAGGACTCTGCAGG - Intergenic
1111805785 13:93039374-93039396 AAGAGCCTCTGGGAATCTGTTGG + Intergenic
1112101899 13:96198267-96198289 CTGGGCCTCTGGGCCTGTGATGG + Intronic
1112451039 13:99509686-99509708 CTGGGCCTCTGGGCCTGTGGTGG + Intronic
1113280478 13:108782639-108782661 CTGGGCCTCTGGGCCTGTGATGG - Intronic
1113625108 13:111789259-111789281 CAAGGCCTCTGGCTCTCTGTTGG + Intergenic
1113793506 13:113043165-113043187 CACCGCCTCTGCGACACTGGCGG - Intronic
1114485409 14:23058722-23058744 CAGGGGCCCTGGGACTCAGGAGG + Exonic
1116170734 14:41398846-41398868 CAGGGAATCAGGGACTCGGGTGG - Intergenic
1117038795 14:51751683-51751705 AAGGGCCTATCGAACTCTGGGGG + Intergenic
1117181906 14:53200261-53200283 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
1118599870 14:67464443-67464465 CAGAGCCTGTAGGGCTCTGGAGG - Intronic
1118699953 14:68423315-68423337 CAGGGCCGCTGGGGCTTTGGGGG - Intronic
1118760876 14:68879561-68879583 AGTGGCCTCTGGGACTCTGCTGG - Intronic
1118767590 14:68920595-68920617 CAGGGCCCCGGGGAGTCTCGGGG + Intronic
1119226451 14:72947884-72947906 CCTGGCCTCTGGGACCCTTGGGG + Intronic
1120083112 14:80237371-80237393 CTGGGCCTCTGGGCCTGTGATGG + Intronic
1120103254 14:80467699-80467721 CAGGGCCTCTTGGGTTATGGAGG - Intergenic
1120161245 14:81147371-81147393 CAGGCTCACTGGGACTCTGCAGG - Intergenic
1120394000 14:83944530-83944552 CTAGGCCTCTGGGCCTGTGGTGG + Intergenic
1120523315 14:85549284-85549306 CAGGGCCTCTGGGACTCTGGGGG + Intronic
1120822062 14:88921118-88921140 CAGGCTCTGTTGGACTCTGGTGG - Intergenic
1121146964 14:91592865-91592887 CTGGGCCTCTGGGCCTTTGATGG - Intronic
1121466389 14:94118069-94118091 CAGGTCCTCTGGGAACCGGGAGG - Intergenic
1121611477 14:95283994-95284016 CTGGGCCTCTGGGGCTGTGATGG - Intronic
1121671640 14:95714509-95714531 CCGGGACTCTGGGCCTCTGCTGG + Intergenic
1121881845 14:97507981-97508003 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
1121905346 14:97736708-97736730 CAGGGCCTGTTGGAATGTGGGGG - Intergenic
1122266627 14:100549758-100549780 CCAGGCCACTGGGAATCTGGGGG + Intronic
1122388414 14:101364328-101364350 CAGGGCCTGTGGGATGCTGGGGG - Intergenic
1122542254 14:102505066-102505088 CTGGGCCTCTGGCATTGTGGAGG + Exonic
1122694075 14:103544396-103544418 TAGGGCCTCTGGGGCTCCTGGGG - Intergenic
1122715148 14:103692253-103692275 CAACGCCTCTGTGACACTGGGGG - Intergenic
1123054234 14:105561669-105561691 CAGGCCCACTCGGGCTCTGGAGG - Intergenic
1123078818 14:105682088-105682110 CAGGCCCACTCGGGCTCTGGAGG - Intergenic
1124483602 15:30098019-30098041 CAGGGCAGCCGGCACTCTGGAGG - Intergenic
1124519976 15:30399207-30399229 CAGGGCAGCCGGCACTCTGGAGG + Intergenic
1124538678 15:30567017-30567039 CAGGGCAGCCGGCACTCTGGAGG - Intergenic
1124759972 15:32440565-32440587 CAGGGCAGCCGGCACTCTGGAGG + Intergenic
1125304259 15:38291810-38291832 CTGGGCCTCTGGGCCTGTGATGG + Intronic
1125879968 15:43185356-43185378 CAGGGCCTCTGGGACGGGGCTGG + Exonic
1126815007 15:52446155-52446177 CTAGGCCTCTGGGCCTGTGGTGG - Intronic
1127576306 15:60295479-60295501 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
1127627410 15:60793899-60793921 CAGTGCCTCTGTGATTCTGCCGG + Intronic
1127772201 15:62241355-62241377 CAGGGCAGCTGGCACTCTGGAGG + Intergenic
1128313786 15:66647488-66647510 CAGGCCCTCAGCCACTCTGGCGG - Intronic
1128358891 15:66946703-66946725 AAGGGATTCTGGAACTCTGGAGG + Intergenic
1129039188 15:72670961-72670983 CAGGGCAGCTGGCACTCTGGAGG - Intergenic
1129469405 15:75742473-75742495 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
1129508960 15:76106036-76106058 CTGTGCATCTGGGAATCTGGAGG - Intronic
1129596460 15:76968049-76968071 CAGAGCCACTGGGATTCTGCTGG + Intergenic
1129966135 15:79737579-79737601 CAGGCCCTGGGGGACTCTTGAGG - Intergenic
1130144538 15:81263832-81263854 CAGGGAGACTGGGATTCTGGAGG + Intronic
1130409380 15:83631745-83631767 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
1130549143 15:84878713-84878735 CAGGGCCTCTGGGTGTCAGTAGG - Intergenic
1132090970 15:98947818-98947840 CAGGGCCTCTGTGTCACAGGTGG - Intronic
1132283234 15:100638844-100638866 CAGGGCCTGTGGGAGAGTGGGGG - Intronic
1132301615 15:100779624-100779646 CATTGCCTCTGGGCCTCTTGGGG - Intergenic
1132335936 15:101048811-101048833 CGGAGCCTCTGGGACACTCGTGG - Intronic
1132388135 15:101416602-101416624 CTGGGCCTCTGGGCCTCTGATGG - Intronic
1132521486 16:392006-392028 CTGGGCTTCAGGGGCTCTGGTGG - Intergenic
1132611154 16:816933-816955 GGGGGGCTCTGGGTCTCTGGTGG + Intergenic
1132727922 16:1346739-1346761 CAGGGCCTCCGGCACCCTGCAGG - Intronic
1132826901 16:1909668-1909690 CAGGGCCTGTGGGACTCAGCGGG + Intergenic
1132891525 16:2207131-2207153 CAGGCACCCTGGGACTTTGGAGG + Intronic
1132940263 16:2502788-2502810 GAGGGCCTCAGGGGCTCAGGCGG - Exonic
1133317688 16:4894481-4894503 CAGGGCCTCAGGGTCTGTGGGGG + Exonic
1133860699 16:9592304-9592326 CAGAGACTGGGGGACTCTGGGGG - Intergenic
1134014703 16:10879863-10879885 GAGGGGCTGTGGGACTCAGGAGG - Intronic
1134204633 16:12227125-12227147 CAGTGCATCTGGGGGTCTGGCGG + Intronic
1136064610 16:27750281-27750303 CAAGGCCTCTGGAACCCTGGCGG + Exonic
1136109380 16:28055079-28055101 CAGGGCCACTGGGCTCCTGGAGG - Intronic
1136530344 16:30864110-30864132 CAGGGCCTCGGTGATTTTGGAGG - Intronic
1137395475 16:48113901-48113923 CAAGGGCTCTGGGGATCTGGAGG - Intronic
1138280430 16:55768720-55768742 CAGGGGCTCTGGGAACCTGGAGG + Intergenic
1138448347 16:57078437-57078459 CCAGCACTCTGGGACTCTGGGGG - Intronic
1139064589 16:63297227-63297249 CAGGGTCTCTGGGGGTGTGGAGG - Intergenic
1139290061 16:65849803-65849825 CAAGGACTCTGGAACTGTGGAGG + Intergenic
1139531277 16:67543871-67543893 CAGGGCCTCTGGGAGAGTCGGGG - Intronic
1139571267 16:67814162-67814184 CAGTGTCTCTGGGAATCCGGAGG + Intronic
1139812816 16:69636780-69636802 CTGGGCCTCTGGGCCTATGATGG + Intronic
1140564647 16:76027220-76027242 CCTGCCCTCTGGCACTCTGGGGG + Intergenic
1140623337 16:76763125-76763147 TTAGGCCTCTGGGACTGTGGTGG - Intergenic
1141736834 16:85859721-85859743 CAGGGCCGCGGGGCCGCTGGAGG + Intergenic
1141883838 16:86878564-86878586 CAGGGCCCCTGGGACCCTCAGGG + Intergenic
1141897692 16:86969092-86969114 CAGGGCCCCTGGGGCTTGGGAGG - Intergenic
1142218564 16:88841754-88841776 CTGGGTCTCTGGGACTTAGGTGG - Intronic
1142301707 16:89262456-89262478 CACGCCCTCTGGGGCTTTGGGGG - Intergenic
1143009275 17:3857072-3857094 CGGTCCCTCTTGGACTCTGGTGG + Intergenic
1143112579 17:4560565-4560587 CAGGGCCTCTGAGACACAGCCGG - Exonic
1143450310 17:7032349-7032371 CAAGGCCTCTGGGCCTGTGATGG + Intergenic
1143840647 17:9728749-9728771 CAGGCCCTCTGGGATCCTGAGGG - Exonic
1144399705 17:14884128-14884150 CTAGGCCTCTGGGCCTCTGATGG + Intergenic
1144750491 17:17644910-17644932 CAGAGCCTGTGGGAATCCGGGGG + Intergenic
1144829187 17:18122078-18122100 CAGGGGCTCTGGGGCCCTGATGG - Exonic
1144844598 17:18210063-18210085 CAACTCCTCTGGGACGCTGGCGG - Intergenic
1145357074 17:22168579-22168601 CAGGGTCTCTGGGCCTATGATGG + Intergenic
1145405296 17:22585088-22585110 CAGGGACTCTGGGTTTGTGGAGG - Intergenic
1146164467 17:30576872-30576894 GAGGCCCTCAGGGACTCAGGAGG - Intergenic
1146695632 17:34907471-34907493 CAGGGCTTCTCACACTCTGGTGG - Intergenic
1147037840 17:37695094-37695116 CTAGGCCTCTGGGCCTCTAGTGG - Intronic
1147308286 17:39578570-39578592 CTGGGCCCCTGGGTCTCTGCAGG - Intergenic
1147310532 17:39593472-39593494 CTGGGCCCCTGGGACACTTGAGG - Intergenic
1147515574 17:41114546-41114568 CATGCCCTCTGGGGCTATGGGGG + Intergenic
1149597344 17:57872204-57872226 CAGGGGCTCTGGAACTTTGCAGG - Intronic
1149603848 17:57911153-57911175 CAGGGAATCAGGAACTCTGGGGG - Intronic
1149661811 17:58338116-58338138 CTGGGGCTCTGGGGCCCTGGCGG - Intergenic
1149996711 17:61409610-61409632 CAGGGCGGCTGGGGCGCTGGCGG + Intergenic
1150291263 17:63983668-63983690 CTGGGCCTCTGAGTGTCTGGAGG - Intergenic
1151281851 17:73081936-73081958 AATGGACTCTGGGAATCTGGTGG + Intronic
1151498397 17:74473448-74473470 CAGGGCCGCATGGACCCTGGGGG - Intronic
1151568770 17:74915671-74915693 CCTGGGCTCTGGGCCTCTGGAGG - Intergenic
1151705467 17:75764890-75764912 GCGGGCCTCGGGGACGCTGGGGG - Intronic
1151884717 17:76916718-76916740 CAGGGCCTCTGTGAATCTCAGGG + Intronic
1153094196 18:1382723-1382745 CTGGCCCTCAGTGACTCTGGGGG + Intergenic
1154092912 18:11381498-11381520 CAAGGCCTCTGGGCCTCTGATGG + Intergenic
1154191125 18:12231715-12231737 CTGTGCCTCTGGGACTCCAGTGG - Intergenic
1154411962 18:14146461-14146483 CAGGGCGTCTGGGCATCTGACGG + Intergenic
1154442940 18:14409020-14409042 CAGGCCCTCTGGGGCTCTGGGGG + Intergenic
1155675600 18:28425566-28425588 CTGGGCCTCTGGGTCTGTGATGG - Intergenic
1156910825 18:42409231-42409253 CAAGGCCTCTGGGCCTGTGATGG + Intergenic
1157335208 18:46732872-46732894 CAGTGCCTCTGGGTCTCGGGAGG + Intronic
1157934390 18:51857317-51857339 AAGGGCCTCTGGGGCACTGCGGG + Intergenic
1158184844 18:54760080-54760102 CACACCCTCTGGGACTCTGGAGG + Intronic
1159258221 18:65976532-65976554 CATGTCCTCTCGGGCTCTGGAGG - Intergenic
1159433309 18:68384118-68384140 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
1159641160 18:70864605-70864627 CTAGGCCTCTGGGACTATGATGG - Intergenic
1160255369 18:77243717-77243739 CAGCTGCTCTGGGTCTCTGGAGG - Intergenic
1161252190 19:3286104-3286126 CCGGGCCTCTGGGACCCGCGGGG + Intronic
1161284658 19:3463162-3463184 CAGGGCCTCCGGGGCGCGGGCGG - Intronic
1161295706 19:3519226-3519248 CAGGGCAGCAGGGACTCTGCAGG - Intronic
1162382442 19:10339560-10339582 CAGGGCCTGCTGGACTCTGCTGG - Exonic
1163038307 19:14584450-14584472 CATGGCCTCAGGGTCCCTGGTGG - Intronic
1163038999 19:14588711-14588733 CATGGCCTCAGGGTCCCTGGTGG - Intronic
1163077138 19:14903928-14903950 CAGTGTCTTTGGGACTGTGGTGG + Intergenic
1163152222 19:15422363-15422385 CAGGGGCTCTGGGGCCCTGGAGG - Exonic
1163554226 19:17983368-17983390 CAGGGCCCGTGGGAGTATGGGGG - Intronic
1163611603 19:18304645-18304667 CCGGGCCTGTCGCACTCTGGCGG + Intergenic
1163725155 19:18919189-18919211 CAGGGGCGCGGGGACGCTGGGGG - Intronic
1163738443 19:18995949-18995971 CAGGGCCCTGGGGCCTCTGGAGG + Intronic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1164210003 19:23090676-23090698 CTGGGCCTCTGGGCCTGTGATGG - Intronic
1165283416 19:34816905-34816927 CAGAGCAACTGGGACACTGGTGG + Intergenic
1165392699 19:35547576-35547598 CAGGGCCTCTGAGACCCAGGTGG - Intergenic
1165969385 19:39613768-39613790 CTGGGCCTCTGGGCCTATGATGG - Intergenic
1166250106 19:41564002-41564024 CAGGGCCTCTGGTACTGGGCAGG + Intronic
1166524753 19:43504116-43504138 CATGGCCGCTGGGACTCCTGCGG + Exonic
1166539427 19:43595503-43595525 CAGGACGCCTGGGATTCTGGGGG - Intronic
1166792188 19:45404965-45404987 CAGGGCCTCTGGTCCCCAGGAGG + Intronic
1166795489 19:45423231-45423253 CGGGGCCCCTGGGAGGCTGGGGG - Intronic
1167071898 19:47226680-47226702 CAGCGCCCCGGGGGCTCTGGCGG - Exonic
1167264740 19:48478002-48478024 CAGGGCCTCTGGGAGATGGGAGG - Intronic
1167271999 19:48511202-48511224 CAGGGCCTCTGGGAGAATTGGGG - Intronic
1167342138 19:48922246-48922268 CTGGGCCTCTGGGGTCCTGGGGG + Intronic
1167403431 19:49288382-49288404 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
1167423181 19:49415584-49415606 CAGGGCCCCTGGGGCTCTTCAGG + Intronic
1168195647 19:54771930-54771952 CAGGAGCTCTGGGATTCAGGAGG - Intronic
1168197546 19:54786784-54786806 CAGAAGCTCTGGGACTCAGGAGG - Intronic
1168199584 19:54805114-54805136 CAGAAGCTCTGGGACTCAGGAGG - Intronic
925443581 2:3908709-3908731 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
925456230 2:4018764-4018786 CTGGGCCTCTGGGCCTGTGGTGG + Intergenic
925985482 2:9211702-9211724 CAGGGCCCCTGGGAGCCTGCAGG - Intronic
926110922 2:10183351-10183373 CCGAGCCTCTGGGACACTGGAGG + Intronic
926297492 2:11579208-11579230 GAGGAGCTCTGGGCCTCTGGAGG - Intronic
926975066 2:18506590-18506612 CAGGGCTTCTGGGGTTCTGTAGG - Intergenic
927211914 2:20644303-20644325 CAGGGGTTCAGGGACTCTTGGGG - Intronic
927882395 2:26697937-26697959 TAGGACCTCTGGGATTTTGGGGG - Intronic
927903606 2:26841429-26841451 CAAGCCCTCTGAGACACTGGAGG + Intergenic
928121973 2:28590246-28590268 CCAGGCCTCTGGGTCACTGGGGG - Intronic
928322504 2:30294979-30295001 CAGGGACCCTGGGCCTCTGCAGG + Intronic
928692056 2:33810280-33810302 CATGGCCTCTGGGGGACTGGGGG - Intergenic
929080331 2:38116235-38116257 CAGGAGATCTGGGCCTCTGGTGG - Intergenic
929108683 2:38388241-38388263 CAGGGCCTATGTGACTTAGGTGG + Intergenic
929789057 2:45010508-45010530 CAGGGACTCTAGGACGGTGGTGG + Intergenic
930987448 2:57607762-57607784 CAGGGCCTGTTGGAGGCTGGGGG + Intergenic
932137674 2:69245155-69245177 CAGGGCCTGTGGTGCTGTGGTGG - Intronic
932331812 2:70901977-70901999 GAGAGCCACTGGGCCTCTGGAGG + Intronic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932594612 2:73086352-73086374 AATGGCCTCTTGGAATCTGGAGG - Intronic
933844586 2:86315078-86315100 CAGGGCCCTTGAGACCCTGGAGG + Intronic
933985776 2:87591201-87591223 CTGGGCCTCTGGGCCTATGATGG - Intergenic
934520170 2:95015146-95015168 CAGAGACTCTGGGAGGCTGGAGG - Intergenic
934522744 2:95030253-95030275 CACAGCCTCTGTGGCTCTGGAGG - Intronic
934568840 2:95355498-95355520 CAGGGCCTGTTGGAGGCTGGGGG - Intronic
934610630 2:95732611-95732633 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
934708529 2:96500989-96501011 GAGGGACTCTGGGATACTGGGGG - Intronic
935436931 2:103045429-103045451 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
936146074 2:109981375-109981397 CTGAGCCTGTGGGACTCTTGGGG + Intergenic
936198616 2:110390104-110390126 CTGAGCCTGTGGGACTCTTGGGG - Intergenic
936308066 2:111359603-111359625 CTGGGCCTCTGGGCCTATGATGG + Intergenic
936327955 2:111521957-111521979 CAGGGCCTACGAGACCCTGGAGG + Intergenic
936683704 2:114803963-114803985 CAGGGCCTCCGGGCCTGTGATGG - Intronic
937285328 2:120747349-120747371 CAGGGCCTCAGAGACACTGGCGG + Intronic
937301214 2:120843596-120843618 CAGGGCAGCTGGGACTCTGCAGG + Intronic
937840433 2:126519273-126519295 CATGCCCTCTGGGACTCTGGGGG + Intergenic
938686433 2:133742429-133742451 CAGGGCCTCTGGGCCTGTGATGG + Intergenic
939101274 2:137897519-137897541 CATGCCCTCTGGGGCTCTGGGGG - Intergenic
939559328 2:143714390-143714412 CTGGGCCTCTGGGCCTGTGATGG + Intronic
939584012 2:143985061-143985083 CATGCCCTCTGGTGCTCTGGGGG + Intronic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
941142846 2:161806249-161806271 CTGGGCCTCTGGGTCTGTGATGG + Intronic
941184886 2:162309376-162309398 CTTGGCCTCTGGGTCTGTGGTGG + Intronic
941536028 2:166723092-166723114 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
942380462 2:175385824-175385846 CTAGGCCTCTGGGTCTCTGATGG - Intergenic
943315841 2:186386270-186386292 CTAGGCCTCTGGGACTGTGATGG + Intergenic
945047945 2:205798473-205798495 CAGGCCCTCTGGGGCTCCAGGGG - Intergenic
945433741 2:209795550-209795572 CTGGGCCTCTGGGCCTGTGATGG - Intronic
946023339 2:216656868-216656890 CAGGAGCTCTGGGAGTCTGCTGG - Intronic
946331878 2:219014099-219014121 CAGGGGCTCTGAGACCCTGATGG + Intronic
946515434 2:220405814-220405836 CTGGACCTCTGGGCCTGTGGTGG + Intergenic
946930170 2:224662890-224662912 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
947028323 2:225763896-225763918 CAGGGCCCTTGGGAATGTGGGGG + Intergenic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
947700790 2:232232292-232232314 CAGGGCAGCAGGGCCTCTGGAGG + Intronic
947713813 2:232330152-232330174 CAGGGCCCCTGTGACTCAGAGGG - Intronic
948025066 2:234770238-234770260 CAGGGCCTCAGGGAGGCTGTGGG - Intergenic
948281918 2:236753394-236753416 CAGGGACCCAAGGACTCTGGAGG - Intergenic
948587208 2:239026909-239026931 CAGGTGCTCCGGGACTGTGGCGG - Intergenic
948614606 2:239190387-239190409 CAAGGCCTCTGGGCCTGTAGCGG - Intronic
948972909 2:241443157-241443179 GAGTCCCACTGGGACTCTGGGGG + Intronic
1168910083 20:1440538-1440560 CAGGGCCTATGGGGCTCTGCAGG + Intergenic
1170091852 20:12597818-12597840 AAGAGCCTCTGGAACACTGGGGG + Intergenic
1171189894 20:23151373-23151395 CAGGGAGGCTGGGCCTCTGGAGG + Intergenic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1171440004 20:25152650-25152672 AAGGGCCTCTGGGCTTCTGAGGG - Intergenic
1172013178 20:31858272-31858294 CTGTGCCTCTGGGACTGGGGGGG - Intronic
1172182781 20:33013803-33013825 CAGGGGCTCTGGGGCGCTGTAGG - Exonic
1172190075 20:33056610-33056632 CGGGGCCTCTTGGGCTCAGGAGG + Exonic
1172228294 20:33319941-33319963 CCAGGCCTCTGTGACTCTGTGGG - Intergenic
1173495355 20:43514284-43514306 CTGGGCCTGTGGGTGTCTGGGGG + Intronic
1173495384 20:43514382-43514404 CTGGGCCTGTGGGAGCCTGGGGG + Intronic
1173595702 20:44257518-44257540 CTGTGGCTCTGGGGCTCTGGGGG - Intronic
1173857738 20:46261664-46261686 CAGTGCCGCTGGGACTCAGTGGG - Intronic
1174252581 20:49230726-49230748 CAGGGCCTCTGTGACTGCAGTGG + Intronic
1174306262 20:49616165-49616187 CTGGGCCCCTGGGGCTCTGATGG - Intergenic
1174819445 20:53714002-53714024 CAGCGCCTCTGGGACACCTGTGG - Intergenic
1175928962 20:62484629-62484651 CTTGGGCTCTGGGACCCTGGGGG + Intergenic
1175943851 20:62549931-62549953 CAGAGCCGATGGGACTGTGGAGG + Intergenic
1176222297 20:63975410-63975432 CAGCGCCTCTTGGACCCTGCGGG - Exonic
1176453144 21:6882184-6882206 CATGCCCTCTGGGGCTCTGGGGG - Intergenic
1176657742 21:9602829-9602851 CTAGGCCTCTGGGCCTGTGGTGG + Intergenic
1176831317 21:13747232-13747254 CATGCCCTCTGGGGCTCTGGGGG - Intergenic
1176861073 21:14011870-14011892 CAGGGCGTCTGGGCATCTGACGG - Intergenic
1177130393 21:17248234-17248256 CTAGGCCTCTGGGACTGTGATGG - Intergenic
1177834439 21:26172879-26172901 CAGGGCCTGTGAGACTCTCCAGG + Intergenic
1178109793 21:29358368-29358390 CAGGAACTCAGGGACTTTGGAGG + Intronic
1178488682 21:33034253-33034275 CAGGGCCTCCAGGACTCAGCAGG - Intergenic
1179235350 21:39540618-39540640 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
1179729874 21:43361762-43361784 CAGAGCCACTGGAACTCAGGAGG - Intergenic
1179911022 21:44448922-44448944 CAGGGCCACTGGGAGAGTGGAGG + Intergenic
1179911371 21:44450721-44450743 CAGGGGCTCCAGGGCTCTGGGGG - Intergenic
1180063780 21:45402802-45402824 CAGAGCCTCCAGGACCCTGGTGG + Intergenic
1180076256 21:45464636-45464658 GGGTCCCTCTGGGACTCTGGAGG + Intronic
1180155845 21:45977164-45977186 CAGGGCCTCTCTGACTCCTGCGG - Intergenic
1181673309 22:24436166-24436188 CTGGGCCTCTGGGCATGTGGAGG + Intronic
1182299364 22:29329212-29329234 CAGACCTTCAGGGACTCTGGGGG - Intronic
1182330222 22:29546247-29546269 CTGGGCCTCTGGGCCTGTGAGGG + Intronic
1183101010 22:35584063-35584085 CAGAGCCTATGGCCCTCTGGGGG - Intergenic
1183258290 22:36777192-36777214 CAGGGCCCCTGGGATTCTGATGG + Intergenic
1183270590 22:36860391-36860413 CAGGGCCTCAGGGGCATTGGAGG + Intergenic
1183466404 22:37982520-37982542 CAGGGAACCTGGGACTCTGAGGG + Intronic
1183723973 22:39578309-39578331 AAAGGCCTCTGGGACTCTCTGGG + Intronic
1184081306 22:42222491-42222513 CAGGGCTTCAGGGCCTATGGGGG - Intronic
1184152252 22:42646007-42646029 CAGGGCCTCTGGCTTTCTGGAGG - Intronic
1184500611 22:44869347-44869369 CAGGGCCTCTGGGCAGCTGTAGG - Intergenic
1185169226 22:49282744-49282766 CAGGGCCTCTGTGTCTCCTGGGG - Intergenic
1185296249 22:50056763-50056785 CAGGAAATCAGGGACTCTGGGGG - Intronic
1185311577 22:50158656-50158678 CAGTGGCTCTGGAGCTCTGGTGG + Intronic
949302081 3:2595594-2595616 CAGCGCCTGAGGGTCTCTGGGGG - Intronic
949684256 3:6549737-6549759 CATGCCTTCTGGGGCTCTGGGGG + Intergenic
950163792 3:10779034-10779056 CAGGGGTGCTGGGACTCTCGAGG - Intergenic
951920871 3:27852824-27852846 CTAGGCCTCTGGGCCTCTGATGG + Intergenic
952139123 3:30458907-30458929 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
952397037 3:32930337-32930359 CTAGGCCTCTGGGCCTCTGATGG - Intergenic
952605936 3:35146476-35146498 CAAGGCCTCTGGGCCTGTGATGG + Intergenic
952827647 3:37537573-37537595 CAGGGTGTCTGGCACTCTGTAGG - Intronic
952920371 3:38279733-38279755 TGAGGCCTCTGGGACTCTGAAGG + Intergenic
953756165 3:45647583-45647605 CAGGGCATATGGGACCCTGCTGG - Intronic
954125472 3:48525478-48525500 GAGGGCCTGTGGGGCTCTGCAGG - Intronic
954213068 3:49109108-49109130 CTGGGCCCCTGGGTCCCTGGGGG - Exonic
954660858 3:52226165-52226187 CAGGGGCTCTGGGAATGTGGAGG - Intergenic
954809672 3:53240287-53240309 CAGGGCCTCGGGGCCGCTTGTGG - Exonic
954895607 3:53972605-53972627 CAGGGCCTCACGGACCATGGAGG - Intergenic
956148881 3:66220884-66220906 CGGGGCCTCGGGGAGTGTGGTGG - Exonic
956683041 3:71799352-71799374 CTGGTCCTCTGGGATTCTAGAGG - Intergenic
956742014 3:72282517-72282539 CAGAGACCCTGGGACTGTGGGGG + Intergenic
956962738 3:74421698-74421720 CAGGGACTGTGCGACTCTGTGGG + Intronic
957041425 3:75338347-75338369 CAGTGCCTCTGACACTCTGAAGG - Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
957663011 3:83185185-83185207 CAGGGCCTCTCAGGCTGTGGGGG - Intergenic
958152137 3:89704320-89704342 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
958611943 3:96436980-96437002 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
959695730 3:109246760-109246782 CTGGGCCTCTGGGTCTGTGATGG + Intergenic
960949437 3:122989521-122989543 AAGGGCCTCTGGGGCTCTGAAGG + Intronic
961480080 3:127173902-127173924 CAGGACCTCTGGGACACATGGGG + Intergenic
961564032 3:127750543-127750565 CAGGGCCCCTGGGACTCACAGGG + Intronic
962769913 3:138602672-138602694 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
962866540 3:139452126-139452148 CAGGACCCCTGAGACTGTGGAGG + Intergenic
963348607 3:144125933-144125955 CAGGGGCTCTGGAACTTTGCTGG + Intergenic
963976005 3:151481106-151481128 CAGAGCCTCTGGATCTCTGGGGG - Intergenic
964940497 3:162154360-162154382 CAGGGCCTCAGTGATTTTGGAGG + Intergenic
965300794 3:167002372-167002394 TACGGCCTCTGGAGCTCTGGGGG - Intergenic
965711873 3:171563636-171563658 CAGGGCCACTATGGCTCTGGAGG - Intergenic
966446619 3:180007887-180007909 CTGGGCCTCTGGGCCTGTGATGG + Intronic
966470354 3:180282234-180282256 TAGGTCCTCTGGGACTCTAGTGG - Intergenic
966761046 3:183419285-183419307 CTAGGCCTCTGGGACTGTGATGG + Intronic
966764424 3:183447439-183447461 CTCGGCCTCCGGGACCCTGGGGG - Intergenic
967092823 3:186149794-186149816 CAAGGCCTGTGGGAATGTGGAGG + Exonic
967558979 3:190895957-190895979 CAAGGCCTCTGGGCCTGTGATGG - Intergenic
967917586 3:194590316-194590338 CAGGGTCACTGGGAATCAGGTGG - Intronic
967986298 3:195097962-195097984 CTGGGACTGTGGGACTCTGTGGG - Intronic
968285767 3:197507870-197507892 GAGGGGCTCTGGTGCTCTGGGGG - Intergenic
968830498 4:2931070-2931092 CAGGGCCGCGGGGCCCCTGGTGG - Exonic
968950389 4:3688502-3688524 CAGGGCCTTAGGGACCCAGGTGG - Intergenic
969521021 4:7677860-7677882 CAGGGCCTTTGGGACACTAGGGG - Intronic
969734217 4:8976213-8976235 AAGGGCCTCTTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
971499278 4:27300878-27300900 CTGGGCCTCTGGGTCTGTGATGG + Intergenic
971831891 4:31705130-31705152 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
972002718 4:34058784-34058806 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
972562794 4:40243546-40243568 CTGGGCCTCTGGGACACAGCCGG + Exonic
973728163 4:53796527-53796549 CAGGGCCTCTGTCTCTCTGGAGG - Intronic
975186473 4:71409789-71409811 CTGGGCCTCTGGGCCTGTGATGG - Intronic
975415809 4:74103143-74103165 CTGGGCTGCTGGGACTCTGGAGG - Intergenic
975632368 4:76416524-76416546 CTGGGCCTCTGGGCCTGTGTTGG - Intronic
975828703 4:78346808-78346830 GATGGGCTCTGGGACACTGGGGG - Intronic
977996497 4:103502409-103502431 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
979184074 4:117766013-117766035 CAGAGCATCTGAGACTCTTGAGG - Intergenic
980903402 4:138926375-138926397 GAGGGCCTGTGGGACTGTGTAGG - Intergenic
981131330 4:141161618-141161640 CTAGGCCTCTGGGCCTGTGGTGG - Intronic
981799383 4:148637655-148637677 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
982219559 4:153112895-153112917 CAGGGCCACAGTGCCTCTGGAGG + Intergenic
984098023 4:175455284-175455306 CATGCCTTCTGGGGCTCTGGGGG - Intergenic
984417252 4:179477426-179477448 CATGCCCTCTGAGACTCTGAGGG + Intergenic
985278962 4:188268669-188268691 CCAGGCCCCTGGAACTCTGGTGG + Intergenic
985417668 4:189753257-189753279 CTAGGCCTCTGGGCCTGTGGTGG - Intergenic
985719356 5:1481231-1481253 CAGGGACTCTGGGGATCTTGGGG - Intronic
985884742 5:2668821-2668843 CAGGGCCTCTGGGAGCCTGGGGG - Intergenic
986163152 5:5249660-5249682 CAGGCCCTCTGGGGCTCCAGGGG - Intronic
986368242 5:7056166-7056188 CAGGGCCTCTGTGATTTTAGAGG + Intergenic
986455341 5:7912557-7912579 CTAGGCCTCTGGGACTGTGATGG + Intergenic
986538286 5:8815648-8815670 CTAGGCCTCTGGGCCTCTGATGG - Intergenic
986693623 5:10333483-10333505 CAGGGCCGCGGGGACACTTGGGG + Intergenic
986869599 5:12031143-12031165 CTAGGCCTCTGGGCCTATGGTGG - Intergenic
987333055 5:16873894-16873916 CTGGGCCTCTGGGACTGTGATGG + Intronic
988009164 5:25461561-25461583 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
988199582 5:28051245-28051267 CAGGGCCTCAGTGATTTTGGAGG - Intergenic
988768694 5:34409158-34409180 GAGGGGCTCAGGGACTCTGTTGG + Intergenic
989461455 5:41704158-41704180 CAGGGCCTGTCGGAGGCTGGGGG - Intergenic
989532517 5:42524689-42524711 CTGGGCCTCTGGGTCTGTGATGG - Intronic
991658522 5:68927380-68927402 CATGCCCTCTGGGGCTCTGGGGG - Intergenic
992451577 5:76880892-76880914 CAGGGCCTCGGGAATTTTGGAGG + Intronic
993208766 5:84921238-84921260 CTGGGCCTCTGAGTCTCTGATGG - Intergenic
993874540 5:93291377-93291399 CATGGAATCAGGGACTCTGGGGG + Intergenic
993962148 5:94311961-94311983 CAGGAGCTCTGGAGCTCTGGTGG - Intronic
994040183 5:95249995-95250017 CAGGGCCTGTGGGAGAGTGGGGG + Intronic
994494187 5:100488906-100488928 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
994831194 5:104785922-104785944 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
995120835 5:108533793-108533815 CATGTCCTCTGGGGCTCTGAGGG - Intergenic
995244130 5:109918240-109918262 CAAGGCCTCTGGGCCTGTGACGG - Intergenic
995533689 5:113115064-113115086 CATGCCCTCTGGGGCTTTGGGGG + Intronic
996011301 5:118483878-118483900 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
996196293 5:120611416-120611438 CTGGGCCTCTGGGCCTGTGATGG - Intronic
996460135 5:123732432-123732454 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
996576766 5:124984195-124984217 CATGCCCTCTGGGGCTCTAGAGG + Intergenic
996706246 5:126501622-126501644 CATGCCCTCTGGGGCTTTGGGGG - Intergenic
997377349 5:133406544-133406566 CAGGGCATCTAGGAGTGTGGAGG - Intronic
998210515 5:140193783-140193805 CCAGGCCCCTGAGACTCTGGAGG - Intronic
998889304 5:146729541-146729563 CTGGGCCTCTGGGCCTGTGATGG - Intronic
999133406 5:149301259-149301281 CAGGGCCTCTGTCCCTCTGGAGG + Intronic
999203496 5:149832781-149832803 CAGGGAGCCGGGGACTCTGGAGG - Exonic
999346140 5:150820955-150820977 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
999471218 5:151857052-151857074 CAAGGCCTTTGGGAGCCTGGAGG - Intronic
1000050792 5:157561468-157561490 AAGGGCTTCTGGGACTCTGGGGG - Intronic
1000648477 5:163785990-163786012 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
1001315241 5:170637196-170637218 CTGGGCCTGTGGGACTCTAAGGG - Intronic
1002258952 5:177981201-177981223 CCAGGCCTCATGGACTCTGGTGG + Intergenic
1003230079 6:4243764-4243786 CTAGGCCTCTGGGCCTCTGATGG + Intergenic
1003403017 6:5806580-5806602 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
1003783130 6:9451684-9451706 CATGCCCTCTGGGGCTTTGGGGG + Intergenic
1004843757 6:19615280-19615302 CAGAGCGTCTGGGGCTATGGGGG + Intergenic
1004890417 6:20095822-20095844 CTGGGCCTCTAGGATTCGGGTGG - Intergenic
1005228555 6:23671902-23671924 CTAGGCCTCTGGGACTCTGATGG + Intergenic
1006337260 6:33427336-33427358 CAGGGTCTAGGGGTCTCTGGCGG + Intronic
1007663635 6:43501573-43501595 CAGGGCCTCAGTGCGTCTGGTGG - Exonic
1008245117 6:49161790-49161812 CAGGACCTCTGGGCCTGTGATGG + Intergenic
1010636094 6:78260646-78260668 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
1011493558 6:87916791-87916813 CATGCCCTCTGGGGCTTTGGGGG + Intergenic
1012485853 6:99722211-99722233 CTAGGCCTCTGGGCCTCTGATGG - Intergenic
1013235515 6:108194971-108194993 CAGGGTCTGTGGGAGGCTGGAGG + Intergenic
1013404559 6:109831516-109831538 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
1013483771 6:110575744-110575766 CAGGGAGTCTGGGACTCTGTTGG + Intergenic
1014134014 6:117866769-117866791 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
1014715769 6:124862670-124862692 CTGGGCCTCTGGGTCTGTGATGG + Intergenic
1016176266 6:141081187-141081209 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
1017018127 6:150117501-150117523 CAAGGCCTCTGCCACTCTTGAGG + Intergenic
1017997617 6:159546478-159546500 CAGGGCCTTTTGGACTTTGGTGG - Intergenic
1018051741 6:160015395-160015417 CAGGGCCTTTTTTACTCTGGGGG + Intronic
1018536821 6:164829048-164829070 AAGGGTCTCTGGGACTCTCAAGG - Intergenic
1018838083 6:167500088-167500110 CAGGGCCTCTGGGCCCCTTGTGG - Intergenic
1019041861 6:169112552-169112574 CAGGATATCTGGGACTCAGGAGG - Intergenic
1019305887 7:335592-335614 CAGGGCCTGGGGACCTCTGGAGG - Intergenic
1019785762 7:2976362-2976384 CAGGGCTTCAGGGACTGTGAAGG - Intronic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020470068 7:8525554-8525576 CTGGGCCTCTGGGCCTGTGATGG - Intronic
1021881739 7:25101684-25101706 CAGGGCCTCAGAGACTGTGATGG + Intergenic
1022549664 7:31227147-31227169 CTGGGCCTCTGGGCCTCTGATGG - Intergenic
1023797616 7:43806836-43806858 CACAGCCTCTGGGAGGCTGGTGG + Intronic
1024084021 7:45878691-45878713 CTGGGCCTCTGGGCCTGTGTTGG + Intergenic
1024866743 7:53911916-53911938 CCTGGCCTCTAGGACTCTGATGG - Intergenic
1027549512 7:79573756-79573778 CTGGGCCTCTGGGACTGTGATGG - Intergenic
1027560278 7:79719892-79719914 CTAGGCCTCTGGGCCTCTGATGG + Intergenic
1027616338 7:80429535-80429557 CAAGGCCTTTGGCCCTCTGGAGG + Intronic
1027704318 7:81510213-81510235 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
1028249738 7:88526504-88526526 CTGGGCCTCTGGGTCTGTGATGG + Intergenic
1028988223 7:97024215-97024237 CAGGGCGACTAGGACGCTGGGGG - Intronic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1029305574 7:99617179-99617201 CAGGGCCTCGGGGCCGCTGAAGG - Intronic
1029420627 7:100469971-100469993 AAGGGCATCTGGGACTCTTGGGG + Intronic
1029972729 7:104805069-104805091 CAGGGCATCTGAGCCTATGGGGG - Intronic
1030914095 7:115291017-115291039 CAGGCACTCTGGGAGGCTGGGGG + Intergenic
1031769811 7:125829369-125829391 CTAGGCCTCTGGGCCTGTGGTGG + Intergenic
1031791942 7:126117959-126117981 CTGGGCCTCTGGGCCTCTGATGG - Intergenic
1032699359 7:134365171-134365193 GGGAGCCTCTAGGACTCTGGTGG + Intergenic
1032797696 7:135290799-135290821 CATGCCCTCTGGGACTTTGGGGG + Intergenic
1033456459 7:141507884-141507906 CTGGGCCTCTGGGCCTATGATGG + Intergenic
1033634863 7:143202729-143202751 ATGGGCCTCTGGGAATGTGGTGG - Intergenic
1034502053 7:151456945-151456967 CTAGGCCTCTGGGACTGTGATGG + Intergenic
1034623030 7:152471153-152471175 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
1034625506 7:152489130-152489152 GAGGACCCCTGGGATTCTGGAGG + Intergenic
1035219503 7:157397456-157397478 CAGGGCTTCTGGGAATCTTTTGG + Intronic
1035917710 8:3643379-3643401 AAGGCACTCAGGGACTCTGGAGG - Intronic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1037315488 8:17595694-17595716 CAGGGCCTCTAGCCCTGTGGTGG + Intronic
1037539324 8:19856231-19856253 CAAGGCCTCCTGGACTGTGGGGG + Intergenic
1037946243 8:22991282-22991304 CAGGACCCCAGGGACCCTGGTGG - Intronic
1037986654 8:23294576-23294598 GCGGGCCTGTGGGGCTCTGGGGG + Intronic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1039434322 8:37549207-37549229 CTGAGCCTCTGGGCCCCTGGAGG + Intergenic
1039489225 8:37935312-37935334 CAGAGCCTCTGGCACTCTGTTGG - Intronic
1039571432 8:38589678-38589700 CATGGCCTGTGGGAGTCTTGGGG + Intergenic
1040284920 8:46094722-46094744 CAGGGTGTCTGTGTCTCTGGTGG + Intergenic
1040287037 8:46105744-46105766 GCGGGCCTCAGGGACTCAGGGGG - Intergenic
1040288653 8:46113177-46113199 ACGGGCCGCTGGGACTCAGGGGG - Intergenic
1040289192 8:46115721-46115743 GAGGGCCGCTGGGACTCAGGGGG - Intergenic
1040290476 8:46121577-46121599 GAGGGCCTCCAGGACTCAGGGGG - Intergenic
1040293162 8:46135824-46135846 GAGGGCCTCAGGGACTCAGTGGG - Intergenic
1040293346 8:46136680-46136702 GAGGGCCTCAAGGACTCAGGGGG - Intergenic
1040298215 8:46174241-46174263 GAGGGCCACAGGGACTCAGGCGG + Intergenic
1040299703 8:46181507-46181529 CCGGGCCACAGGGACTCAGGGGG - Intergenic
1040303200 8:46198733-46198755 GAGGGCCACAGGGACTCAGGGGG + Intergenic
1040308388 8:46223968-46223990 GAGGGCCACAGGGACTCAGGGGG + Intergenic
1040309266 8:46228242-46228264 GAGGGCCGCAGGGACTCAGGTGG + Intergenic
1040312948 8:46246173-46246195 CAGGGACACTGTGTCTCTGGTGG + Intergenic
1040324598 8:46335346-46335368 GGGGGCCTCAGGGACTCAGGAGG + Intergenic
1040335894 8:46415777-46415799 GTGGGCCTCAGGGACTCAGGAGG + Intergenic
1040336646 8:46419396-46419418 CGGGGCCTCAGGGACTCAGGGGG + Intergenic
1040337143 8:46421761-46421783 GAGGGGCTCAGGGACTCAGGTGG + Intergenic
1040341053 8:46441311-46441333 GCGGGCCTCAGGGACTCAGGGGG - Intergenic
1041008988 8:53523228-53523250 AAGGGCCTGTTGAACTCTGGGGG - Intergenic
1041705578 8:60843287-60843309 CAGGGCTTTTGGGACGCAGGGGG - Intronic
1042135905 8:65632702-65632724 CAAGGCCTCTGGTACTCCAGGGG + Intronic
1042238744 8:66641013-66641035 CATGCCCTCTGGGGCCCTGGGGG + Intronic
1042265982 8:66909883-66909905 CTAGGCCTCTGGGACTATGAGGG - Intronic
1042953647 8:74225677-74225699 CTGGGCCTCTGGGCCTGTGGTGG + Intergenic
1044125338 8:88452441-88452463 CTAGGCCTCTGGGCCTCTGATGG + Intergenic
1044698708 8:94948577-94948599 CAGGGCCTCCGGAACTCGGAGGG + Intronic
1044718524 8:95123658-95123680 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
1044908393 8:97029855-97029877 CAAGGCTTCTGGGAATATGGCGG - Intronic
1046034188 8:108821530-108821552 CAAGGCCTCTGGGCCTGTGATGG - Intergenic
1047611119 8:126521820-126521842 CTGGGCCCCTGGAAGTCTGGTGG - Intergenic
1047628014 8:126677032-126677054 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
1047747989 8:127859602-127859624 CAGGGCAGCCAGGACTCTGGCGG - Intergenic
1047940404 8:129823394-129823416 CTAGGCCTCTGGGTCTCTGATGG - Intergenic
1048012911 8:130472912-130472934 CACGGCCTCTCGGCCTCTCGGGG + Intergenic
1048782924 8:138021670-138021692 CTGGGCCTCTGGGCCTATGATGG - Intergenic
1048806496 8:138246312-138246334 CTGGGCCTCTGGGCCTGTGATGG - Intronic
1048824677 8:138412481-138412503 CAGGTCCTCTGGGACTCACCTGG + Intronic
1048923321 8:139250089-139250111 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
1049217105 8:141413236-141413258 CAGGGCCTCAGGGACTGGGGCGG + Intronic
1049243113 8:141548725-141548747 CTGGGGCCCTGGGAGTCTGGGGG - Intergenic
1049247194 8:141569144-141569166 CTGGGGCTCTGGGAGTCTTGTGG + Intergenic
1049457310 8:142700329-142700351 CAGGGCCTCGCGGCCGCTGGCGG - Exonic
1049473691 8:142787363-142787385 GAGGGCTTCTGGGGCCCTGGAGG - Intergenic
1049572307 8:143375038-143375060 CAGGGTCCCTGAGGCTCTGGGGG - Intronic
1049594822 8:143478381-143478403 CAGGGCCTCTGGGGGTCAGCAGG + Intronic
1049615763 8:143575249-143575271 CAGGGCTCCTGGGCCCCTGGAGG + Exonic
1049784314 8:144443378-144443400 CAGGGTCTCTGGGAATCTGGCGG - Intronic
1050439927 9:5650843-5650865 CAGGGACTCTGCCACTCTGCTGG + Intronic
1050658654 9:7858311-7858333 CAGGGACTCTGGGATGCTGGAGG + Intronic
1050905053 9:10993642-10993664 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
1051382215 9:16470505-16470527 CTGGGCCTCTGGGCCTGTGATGG - Intronic
1051644216 9:19251392-19251414 CAAGGCCTCTGGGCCTGTGATGG + Intronic
1052351819 9:27465924-27465946 CTGGGCCTCTGGGCCTGTGATGG + Intronic
1052614482 9:30821021-30821043 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
1052862758 9:33447058-33447080 CTGGGATTCTGGGAATCTGGAGG + Intronic
1054833332 9:69649768-69649790 CAGGGCCTCAGAGGGTCTGGAGG + Intronic
1054855322 9:69893115-69893137 CATGCCCTCAGGGGCTCTGGGGG + Intronic
1055878423 9:80970536-80970558 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
1056087010 9:83160737-83160759 CTAGGCCTCTGGGCCTGTGGTGG - Intergenic
1056639348 9:88357465-88357487 CTGGGCCTCTGGGTCTGTGATGG - Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1057216646 9:93232292-93232314 CAAAGCCTCTGGCATTCTGGGGG + Intronic
1057749417 9:97779772-97779794 CTAGGCCTCTGGGCCTGTGGTGG - Intergenic
1057832920 9:98420355-98420377 CACAGCCACTGGGGCTCTGGCGG - Intronic
1058076483 9:100657021-100657043 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
1058082288 9:100712727-100712749 CTAGGCCTCTGGGCCTGTGGTGG + Intergenic
1058318496 9:103599428-103599450 CATGTCCTCTGGGGCTCTGAGGG + Intergenic
1058321473 9:103636595-103636617 CACGCCCTCTGGGGCTCTAGGGG + Intergenic
1058834497 9:108848962-108848984 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
1059437821 9:114287151-114287173 CTGGGCCTCTGTGGTTCTGGTGG - Intronic
1059570128 9:115425337-115425359 CTAGGCCTCTGGGCCTCTGATGG + Intergenic
1060188518 9:121578037-121578059 CAGGGCACCAGGGAATCTGGGGG + Intronic
1060275590 9:122179895-122179917 CTGGGCCTCTGGGCCTCAGATGG + Intronic
1060276462 9:122186606-122186628 CAGGGCCTTTGGAACTGGGGTGG - Intronic
1060657465 9:125381751-125381773 CATGGCCTCTTAGCCTCTGGTGG + Intergenic
1061038772 9:128127893-128127915 GCGGGCCTCTGCGGCTCTGGCGG - Exonic
1061062075 9:128255457-128255479 CAGGGCGGCTGGCATTCTGGAGG + Intergenic
1061258434 9:129466163-129466185 CAGGGTCTATGGGAGGCTGGAGG + Intergenic
1061806228 9:133139217-133139239 CAGGGCCTCTGGGCCTGCAGGGG - Intronic
1062058183 9:134479923-134479945 CTGCGTCTCTGTGACTCTGGTGG - Intergenic
1062108119 9:134766804-134766826 CAGCGCCTCTGAGGCTGTGGAGG - Intronic
1062196935 9:135279617-135279639 CATGGCCACAGGGACTCTTGGGG - Intergenic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1062383036 9:136296734-136296756 CTGGGCCGCTGGGTCTCTGCAGG + Intronic
1062408923 9:136411562-136411584 CAGGACCTATGGGAGTGTGGGGG + Intronic
1062570441 9:137182653-137182675 CAGGGCCTCTGCGACCCCTGAGG + Intronic
1203516037 Un_GL000213v1:2331-2353 CATGCCCTCTGGGGCTCTGGGGG + Intergenic
1203635470 Un_KI270750v1:106403-106425 CTAGGCCTCTGGGCCTGTGGTGG + Intergenic
1185751699 X:2615528-2615550 CAGGGCCTCTCAAATTCTGGAGG + Intergenic
1185780194 X:2837126-2837148 CGAGGCTTCTGGGACTCTTGGGG + Intronic
1185887289 X:3794063-3794085 AATGGACTCTGGGACTCAGGGGG - Intergenic
1186452951 X:9688283-9688305 CAGGGGCTCTGGGAGTTCGGTGG + Intronic
1187643447 X:21319537-21319559 CTAGGCCTCTGGGACTGTGATGG + Intergenic
1188755213 X:33953256-33953278 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
1188765050 X:34080632-34080654 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
1189153710 X:38733659-38733681 GAGGACTTCTGGGACTGTGGTGG + Intergenic
1189371241 X:40431336-40431358 CTGGGCCTCTGGGCCTGTGATGG - Intergenic
1189716454 X:43871446-43871468 CAGGGCCTCTGAGGCCCTTGAGG + Intronic
1190220916 X:48511832-48511854 CATGGCCTCTGAGACCATGGGGG - Intronic
1190225905 X:48544820-48544842 CAGGGCCCCTGGTGCCCTGGAGG - Intronic
1191089941 X:56609049-56609071 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
1191095035 X:56665032-56665054 CTAGGCCTCTGGGCCTCTGATGG - Intergenic
1191656515 X:63604738-63604760 CTAGGCCTCTGGGTCTCTGATGG - Intergenic
1192631946 X:72784184-72784206 CAGGGGCTCAGGGACTCCGTGGG - Intronic
1192649763 X:72936617-72936639 CAGGGGCTCAGGGACTCCGTGGG + Intronic
1192988697 X:76428096-76428118 CAGGGCCTCTGCGCCTCTGAGGG + Exonic
1194297342 X:92143349-92143371 CTGGGCCTCTGGGCCTGTGATGG - Intronic
1194626039 X:96227638-96227660 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
1197511163 X:127371080-127371102 CTGGGCCTCTGGGCCTGTGATGG + Intergenic
1197569471 X:128131519-128131541 CTAGGCCTCTGGGACTGTGATGG - Intergenic
1197730451 X:129805153-129805175 AAGTGGCTCTGGGACTCTGCCGG + Exonic
1198890987 X:141395889-141395911 CAGGGCCTCTGCGATTTTGGAGG + Intergenic
1199113324 X:143959673-143959695 CCTGGCCTCTGGGACTGTGATGG + Intergenic
1199310099 X:146311686-146311708 CATGGCCTCTGGGCCTGTGATGG + Intergenic
1199747349 X:150781801-150781823 CAGGGCCTCTGTAGCTATGGTGG - Intronic
1200614910 Y:5368236-5368258 CTGGGCCTCTGGGCCTGTGATGG - Intronic
1200948291 Y:8867426-8867448 AAGGGCCTATAGAACTCTGGGGG + Intergenic