ID: 1120524233

View in Genome Browser
Species Human (GRCh38)
Location 14:85559290-85559312
Sequence AAGAGGGGCCCTTTCTCCTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120524230_1120524233 -7 Left 1120524230 14:85559274-85559296 CCTGAAAACAGAGTAGAAGAGGG 0: 1
1: 1
2: 3
3: 20
4: 312
Right 1120524233 14:85559290-85559312 AAGAGGGGCCCTTTCTCCTTCGG 0: 1
1: 0
2: 3
3: 20
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120524233 Original CRISPR AAGAGGGGCCCTTTCTCCTT CGG Intronic
900379982 1:2378926-2378948 AAGAGGAGCCTTCTCTGCTTTGG + Intronic
900572986 1:3368549-3368571 AAGATGGCCCCTTTCCCCTCAGG - Intronic
901856662 1:12048795-12048817 AAAAGAGGCCCTGTCTCATTGGG - Intergenic
901935295 1:12622415-12622437 AAGAGGGCCCCTTTCCTCCTCGG + Intergenic
902689919 1:18104707-18104729 CAGAGGGGCCCTTTGACCTCTGG + Intergenic
902957269 1:19934137-19934159 AAAAGTGTCCCTTTCTCCTGGGG - Intergenic
903788104 1:25874886-25874908 AAGAGGGGCACTTGCTCCATGGG - Intergenic
904813491 1:33179356-33179378 AACATGGGCCATTTCTCCTGAGG + Intronic
904962272 1:34343331-34343353 AACAGGGGTGCATTCTCCTTAGG - Intergenic
905471641 1:38196608-38196630 AAGAGGGGCCCTTTGTACTTAGG + Intergenic
906144238 1:43550445-43550467 TGGAGGGGCACTTTCTCCCTGGG + Intronic
907332870 1:53682663-53682685 AGGAGAGGCCCTTTCACCATTGG + Intronic
907508965 1:54944256-54944278 ATAAGGGGCTCTTCCTCCTTGGG + Intergenic
907731260 1:57068156-57068178 AAAAGGGGCCCTCTCTTCTTAGG + Intronic
908228163 1:62077132-62077154 AAGACAGGATCTTTCTCCTTAGG + Intronic
909144971 1:71918359-71918381 AAGTGGGACGGTTTCTCCTTTGG + Intronic
910034016 1:82768345-82768367 TGGAGGGGCCTTTTTTCCTTTGG - Intergenic
910168928 1:84357537-84357559 AAGAGGGTCTCTTTGTCCCTTGG + Intronic
913658323 1:120983031-120983053 GATAGGGGCCCTTTCTATTTTGG + Intergenic
914009685 1:143766118-143766140 GATAGGGGCCCTTTCTATTTTGG + Intergenic
914648305 1:149674792-149674814 GATAGGGGCCCTTTCTATTTTGG + Intergenic
914986163 1:152458970-152458992 AAGCGGGGCCCTGTGTCTTTGGG - Intergenic
916890616 1:169108953-169108975 AAAAGGGGCATTTTCTCCGTAGG - Intronic
921550428 1:216528925-216528947 AGGAAGGGCCCTTACTCCCTTGG - Intronic
922770462 1:228179591-228179613 AACAGGAGCCCCTGCTCCTTAGG + Exonic
923099526 1:230801208-230801230 ATGAGGGGTCCTCTCACCTTTGG - Intronic
924404543 1:243729250-243729272 AAGAGGGGGCTTTTCTTTTTAGG + Intronic
924557397 1:245129735-245129757 ACGATGTGCCCTTTCTGCTTTGG + Intergenic
1065610036 10:27463727-27463749 AAGAAGAGCCCTTTCCCATTAGG - Intergenic
1065908818 10:30283561-30283583 AAGAAGAGCCCTTTCCCATTAGG - Intergenic
1067067141 10:43110604-43110626 AAGAGGAGCCTCTTCTCCTGGGG - Intronic
1067222468 10:44353841-44353863 AAGTGGGGCCCTTTCACCGTGGG + Intergenic
1068633412 10:59321836-59321858 AAGAGGCCACCTTACTCCTTGGG - Intronic
1070075481 10:73130768-73130790 TATAGGGGCCCTTTCTCTTCAGG - Exonic
1070838198 10:79464587-79464609 AAGAGTGGCACTTTGTCCTAGGG - Intergenic
1071520035 10:86324562-86324584 AACAGCGGCCCTGTGTCCTTTGG - Intronic
1073512540 10:104051773-104051795 AGAAGGGGCCCATTCTCCCTGGG + Intronic
1074873495 10:117596003-117596025 AAGAGGTGCCCTTTGCTCTTGGG + Intergenic
1075102827 10:119518249-119518271 CAGAGAGCCCCTTTCTCCCTGGG + Intronic
1076102081 10:127790650-127790672 AAGAGGGGCCCTTGCTCTGCAGG - Intergenic
1076420123 10:130325612-130325634 AAAAGGGGCTATTTCCCCTTTGG - Intergenic
1077411867 11:2407444-2407466 ACGAGGGGTCCACTCTCCTTGGG + Intronic
1077490755 11:2859850-2859872 AAGAGGAGCCCTTTCGCTCTGGG - Intergenic
1081405723 11:42695211-42695233 ACGAGGTGCCCTTTCTCCAATGG - Intergenic
1081756194 11:45546422-45546444 AAAAGGAGCCATTTCCCCTTTGG - Intergenic
1083806326 11:65076536-65076558 AAGAGGGGACCCATCTCCTCTGG + Intronic
1084609268 11:70191820-70191842 AAGTGGGTGCCGTTCTCCTTGGG - Intergenic
1086713791 11:90041312-90041334 AGGAGGGACTCTTTCTTCTTGGG + Exonic
1086975011 11:93121275-93121297 ATGGGGAGCCATTTCTCCTTTGG - Intergenic
1087090371 11:94264861-94264883 AAGTGGGACCCTATCTCTTTAGG - Intergenic
1089505045 11:118957137-118957159 AAAAGCTGCCCCTTCTCCTTGGG + Intronic
1090187898 11:124750336-124750358 AATAGGGGCCCTTGTTCCTTTGG + Intronic
1094843861 12:34352984-34353006 GGGAGGGGACCTTTCTCCTGTGG + Intergenic
1095094054 12:38135467-38135489 AAAAGGGGACCTTTCCCCGTAGG - Intergenic
1098021749 12:66163216-66163238 AGCAGGGACTCTTTCTCCTTGGG + Intronic
1099385346 12:82006525-82006547 AAGAGGGACCCATTCTTCTCTGG + Intergenic
1099869164 12:88324798-88324820 AAAAGGGGACCTTTCTCTATAGG - Intergenic
1100789560 12:98115553-98115575 ACAAGGGGCCATTTCTCCTTTGG + Intergenic
1102225092 12:111223064-111223086 AAGGGTGGCCTTGTCTCCTTTGG - Intronic
1103176460 12:118867788-118867810 AAGAGGGGCCCTTAGCCATTTGG - Intergenic
1108968396 13:56341294-56341316 ATAAGGGGCTCTTCCTCCTTGGG - Intergenic
1108968405 13:56341367-56341389 ATAAGGGGCTCTTCCTCCTTGGG - Intergenic
1114473533 14:22979586-22979608 GATGGGGGCCCCTTCTCCTTGGG - Intronic
1116770202 14:49118585-49118607 AAAAGGGGCCATTTCTTCTTTGG + Intergenic
1117336689 14:54762133-54762155 AAGAGCGCCCCTTTCTACCTGGG + Intronic
1118390215 14:65289256-65289278 AAGAGGCACCCTTTCTCCACTGG + Intergenic
1119034164 14:71215762-71215784 AAGAGGCACCCTTTTTCCATGGG + Intergenic
1119690108 14:76664966-76664988 ATCAGGGGCCCTTTTCCCTTGGG - Intergenic
1120323859 14:83000873-83000895 AAGAGGGGCAATTTTTTCTTTGG + Intergenic
1120524233 14:85559290-85559312 AAGAGGGGCCCTTTCTCCTTCGG + Intronic
1121325960 14:93019742-93019764 GAGCTGGGCCCTTTCTCCTGTGG - Intronic
1121794286 14:96722731-96722753 ACGAGGGGCCCTGTCTGCCTGGG + Intergenic
1124349998 15:28948236-28948258 AAGAGGGGCCCTTTGGGCTGAGG + Intronic
1125040954 15:35186812-35186834 AACTGGGGCCCCTTTTCCTTTGG + Intergenic
1125849990 15:42893904-42893926 AAGGAGGTCCCTTTCACCTTGGG - Intronic
1126268784 15:46787868-46787890 AAGAGGAATCCTTCCTCCTTAGG + Intergenic
1127883071 15:63174973-63174995 AAGAGGGGCCTCTTCCCCTGGGG - Intergenic
1130980864 15:88811058-88811080 GACAGGGGCCCTTCCTCCCTTGG + Intronic
1132307306 15:100825784-100825806 AAGAGTGGGCTTTTCTCCTGTGG + Intergenic
1133197249 16:4179847-4179869 TAGCGGGGCCTCTTCTCCTTGGG - Intergenic
1134100406 16:11447933-11447955 AACGGGGGGCCTTGCTCCTTAGG - Exonic
1134210077 16:12268573-12268595 TGGAAGGGTCCTTTCTCCTTCGG + Intronic
1136144188 16:28306169-28306191 AAGAGGGACCCTCTCACCCTGGG + Intronic
1137618430 16:49859714-49859736 CAGAGGGGCCCCTTCTCATAGGG - Intergenic
1137710294 16:50562169-50562191 AAGAGAGGCCCTTACTCGCTGGG - Intronic
1138504600 16:57471771-57471793 GGGAGGGGCCCTTGCTCCTGCGG - Exonic
1139043433 16:63028676-63028698 AAGTGGGGCCTTTTCTGCTTAGG - Intergenic
1142771645 17:2101925-2101947 AAGAGAAGAGCTTTCTCCTTGGG - Intronic
1143771248 17:9170437-9170459 AAGAGGGGCCGGTTCTCCTGAGG - Intronic
1144293890 17:13855002-13855024 CACAGAGGCCCTTTATCCTTTGG - Intergenic
1146087882 17:29847164-29847186 AAGAGCGGCCCAGTCTCCTATGG + Intronic
1146183766 17:30712117-30712139 CAGGGGAGCCCTTTCTCCTGGGG + Intergenic
1148085340 17:44990495-44990517 GAGAGGGACCTTTTCTTCTTGGG - Intergenic
1152836516 17:82536434-82536456 AAAAGGGCCCCTATATCCTTTGG - Intronic
1157214912 18:45774715-45774737 AAGAGGGGTCCTTTCCACATTGG - Intergenic
1157568867 18:48699064-48699086 AAGAGAGGACCTCTCTCCTCAGG - Intronic
1158600763 18:58853989-58854011 AATAGAGGCCCTTTCTCTTGGGG - Intergenic
1161795695 19:6385421-6385443 AAGAGATGGCATTTCTCCTTTGG + Intronic
1162975030 19:14203636-14203658 CAGGGGAGCCCTTTCTCCTGGGG - Intronic
1163710184 19:18841882-18841904 GCGAGAGGCCCTTTCTCTTTGGG + Intronic
1165134904 19:33661645-33661667 ACGGGGGACCCTTGCTCCTTTGG + Intronic
927091776 2:19717860-19717882 GAGAAGTGCCCCTTCTCCTTGGG - Intergenic
929108796 2:38389068-38389090 AAGAGGGGCTCTTTCTTGCTCGG - Intergenic
929578648 2:43068325-43068347 AAGAGGGGCCTTTTGTTCTCTGG - Intergenic
931450835 2:62366430-62366452 AAGAGAAGCCCTCTCACCTTGGG - Intergenic
931895945 2:66729775-66729797 AAGAGAAGGCTTTTCTCCTTGGG - Intergenic
933994405 2:87657199-87657221 GAGAGAGGCCCTTTGTCCCTCGG - Intergenic
936299453 2:111293714-111293736 GAGAGAGGCCCTTTGTCCCTCGG + Intergenic
937627776 2:124062779-124062801 GTTAGGGTCCCTTTCTCCTTGGG + Intronic
941434316 2:165449866-165449888 AATAGGGGCCCTTAATCTTTTGG - Intergenic
942319685 2:174725584-174725606 AACAATGCCCCTTTCTCCTTTGG - Intergenic
945190542 2:207183100-207183122 ATGATGTGCCCTTTCTGCTTCGG + Intergenic
946975138 2:225139898-225139920 AAGAGTGCCCCCTGCTCCTTTGG + Intergenic
947530788 2:230907536-230907558 AAGAAGGGCCTCTTCTCCGTGGG - Exonic
947713807 2:232330136-232330158 CAGAGGGGCCCTTTCTCCCAGGG - Intronic
948849548 2:240698968-240698990 CAGAGGGCCCTTATCTCCTTTGG - Intergenic
948902003 2:240960820-240960842 GAAAGGAGACCTTTCTCCTTGGG - Intronic
1168998242 20:2148136-2148158 AAGAGGCTCCCTTCCTCCTGTGG - Exonic
1169936893 20:10893355-10893377 AAAGGGGCCCCTTTCTCCTGAGG + Intergenic
1170126362 20:12968772-12968794 AATAGGAGCCCATTATCCTTTGG + Intergenic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1172644723 20:36462179-36462201 AAGTTGGGGTCTTTCTCCTTGGG + Intronic
1174929081 20:54793847-54793869 CAGACTGGCCTTTTCTCCTTAGG + Intergenic
1175388923 20:58614279-58614301 AACAGGGTGCCTGTCTCCTTAGG + Intergenic
1176218243 20:63958188-63958210 CAGTGGGGCCCCTTCTCCCTGGG + Exonic
1177690784 21:24504953-24504975 AAGAACTGCCCTTACTCCTTGGG + Intergenic
1179908996 21:44438181-44438203 CAGAGGGGGCCTTTGGCCTTGGG + Intronic
1181020407 22:20098697-20098719 AAGAGAAGGCCTTTCTCCGTGGG + Intronic
1181737171 22:24891424-24891446 CAGACTGGCCCTTTCTCCCTGGG + Intronic
1182437697 22:30341198-30341220 GACAGGGGCCCTTTCTTCTCAGG + Intronic
1183957319 22:41388713-41388735 AACAGGAGCCATGTCTCCTTTGG - Intronic
1184160333 22:42693794-42693816 TAGAGCTGCCCTTTCTCCTTGGG + Exonic
1184806771 22:46799924-46799946 AAGAGCTCCCCTTTTTCCTTTGG + Intronic
949941598 3:9159058-9159080 AACAGAGGCCCTTTGACCTTTGG - Intronic
951353044 3:21629984-21630006 CAGAGGGACACTTTCTCCATAGG - Intronic
952994679 3:38867829-38867851 AGGAGGGGCACGTTCACCTTGGG + Intronic
960233145 3:115252592-115252614 AAGAGGAGCAATTTCTTCTTGGG + Intergenic
963034729 3:141015993-141016015 AAGAGGAGCCCTCTCTCCACTGG - Intergenic
963067761 3:141277520-141277542 AAGAGGTGCTCTTTTTCTTTCGG - Intronic
966417319 3:179702539-179702561 AAGAGGGGACATTTGTGCTTGGG + Intronic
966599139 3:181757866-181757888 TAGAGGAGCCCTTGCTCCTCTGG - Intergenic
966877829 3:184333489-184333511 CAGAGGGGCCTGTCCTCCTTTGG - Intronic
968584819 4:1411392-1411414 CAGAGGGGTCCTTACTCCTCAGG + Intergenic
969495492 4:7523879-7523901 AAGAGGCCCCCTCCCTCCTTGGG + Intronic
970378332 4:15480820-15480842 AAGAGGGGCACTTACTCCGTGGG - Exonic
973130651 4:46644137-46644159 AAGAGTGGCCCTTCTTGCTTAGG - Intergenic
973978908 4:56289983-56290005 CAGAGGGGCCCTTTCTGCAGTGG + Intronic
974565412 4:63574332-63574354 ATGAGGGGCCATTACTACTTGGG + Intergenic
982560527 4:156923994-156924016 AAGAGGGGCCATTTCTTCTCAGG - Intronic
985696511 5:1344067-1344089 AAGCGTGGCCCCTGCTCCTTCGG + Intronic
986423792 5:7610364-7610386 CAGCTGGGCCCTTTCTCCTATGG - Intronic
986517094 5:8575319-8575341 AAGAGGAGCCCATCCTCCTGTGG + Intergenic
987957827 5:24763418-24763440 AAGAGGGGCCCTGTCTTCTCTGG - Intergenic
989657422 5:43759929-43759951 GAGGGGGACCCTTTCTCATTAGG + Intergenic
990756782 5:59080597-59080619 AAAAGGGTGGCTTTCTCCTTAGG + Intronic
993023883 5:82624497-82624519 AAAAGGAGCCCATTCTACTTCGG - Intergenic
993283346 5:85957742-85957764 ATAAGGGGCTCTTTCCCCTTTGG + Intergenic
997512428 5:134462896-134462918 AAGAGGGGCCCCATCCCCTTTGG - Intergenic
998071344 5:139200341-139200363 AAAGCGGGGCCTTTCTCCTTGGG + Intronic
999777506 5:154822859-154822881 CAGAGAGGCCTTTTCTCTTTTGG + Intronic
999802832 5:155053665-155053687 AAGCAGGGACCTGTCTCCTTGGG + Intergenic
1001772226 5:174305169-174305191 AGGAGGGGTCCTAGCTCCTTGGG + Intergenic
1004417166 6:15435541-15435563 AAGTGGGGTCATTTCTCCTTGGG + Intronic
1007187463 6:39984434-39984456 AAGAGGGGGCCCTTCTCCAATGG + Intergenic
1008321015 6:50113768-50113790 AAAAGGGGCATTTTCTGCTTGGG - Intergenic
1009486144 6:64224918-64224940 AAGAGGGGCCATTTTTCCTTGGG - Intronic
1009810247 6:68653146-68653168 GAGAGGAGCCCCTTCTCTTTAGG - Intronic
1010077579 6:71818319-71818341 GTGAGGGGATCTTTCTCCTTAGG - Intergenic
1010879163 6:81146963-81146985 AGGAAGTGCTCTTTCTCCTTGGG + Intergenic
1012401468 6:98845425-98845447 AAGCCGGGCTCTTTCTCCTCCGG - Intergenic
1015983730 6:138865018-138865040 AAGAGGGGGCCTTTCCCCATTGG - Exonic
1016058345 6:139602516-139602538 AAGAGGGGCCCTTTTATCTAGGG - Intergenic
1019653302 7:2172482-2172504 CAGAGGAGCCCTTTGTCCTGAGG - Intronic
1024083885 7:45877911-45877933 AAGAAAGTCCCTTTCACCTTGGG + Intergenic
1025192545 7:56907058-56907080 GGGTGGGACCCTTTCTCCTTTGG - Intergenic
1025679401 7:63669864-63669886 GGGTGGGACCCTTTCTCCTTTGG + Intergenic
1026110638 7:67456356-67456378 AAGATGACCCCCTTCTCCTTTGG + Intergenic
1029669716 7:102021149-102021171 GGGTGGGACCCTTTCTCCTTCGG - Intronic
1031604130 7:123748643-123748665 AAGAGGGACTCGTTCTCCTGCGG + Exonic
1031991604 7:128202469-128202491 AAGTGTGGACATTTCTCCTTGGG - Intergenic
1033147333 7:138882783-138882805 TTGAAGAGCCCTTTCTCCTTCGG - Intronic
1034744796 7:153514284-153514306 AAGGCGGGCCCTTTCTTCTCCGG - Intergenic
1035052680 7:156010571-156010593 AAGAGGGGCCCTTGCTCCATCGG - Intergenic
1035393295 7:158519674-158519696 AAAAGGGCCCCTTTCTCCCTTGG - Intronic
1037439810 8:18903889-18903911 AAGTGGTGCCCTTTCTCCTGGGG - Intronic
1038939591 8:32289312-32289334 AAGAGGGGTCCTTGCTCTGTAGG - Intronic
1040046126 8:42965463-42965485 AAGAAGGGCCCTTTGACCTTTGG + Intronic
1043563253 8:81519985-81520007 AAGAAGGTGCCTTTCTCCCTAGG + Intergenic
1052085127 9:24255864-24255886 AAGAGCTACCCTTTCTCATTGGG - Intergenic
1057083784 9:92190503-92190525 AAGAAGGCCTCTTTCTCCTTGGG + Intergenic
1060455324 9:123787770-123787792 AAAAGGTGCCCTTTCTCTTAAGG - Intronic
1061067572 9:128288160-128288182 AAGACTGGTCCTTTCTCCTGAGG - Intronic
1062104381 9:134745500-134745522 AGGAGGGGCTCTTTATCCATAGG - Intronic
1187006529 X:15238210-15238232 AAGAAGGGCCCTTTGGTCTTAGG - Intronic
1187484798 X:19693385-19693407 AAGAGGGCCCATCTCTCCATCGG - Intronic
1190160248 X:48026999-48027021 AGGAGAGGCCATTTCTCATTTGG + Intronic
1192510889 X:71719751-71719773 AAGAGGCACCCTCTCTCCGTGGG - Intergenic
1192515808 X:71761802-71761824 AAGAGGCACCCTCTCTCCGTGGG + Intergenic
1196014551 X:110923783-110923805 TAGAGGGCAACTTTCTCCTTGGG - Intergenic
1200131549 X:153850926-153850948 AAGGGGAGCACTTGCTCCTTAGG + Intergenic
1200204171 X:154303946-154303968 ACGATGTGCCCTTTCTACTTTGG - Intronic