ID: 1120526870

View in Genome Browser
Species Human (GRCh38)
Location 14:85587203-85587225
Sequence CTTTTAGTATTTCAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 262}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120526866_1120526870 9 Left 1120526866 14:85587171-85587193 CCTACACACATACACACACCAGC 0: 1
1: 3
2: 46
3: 465
4: 4715
Right 1120526870 14:85587203-85587225 CTTTTAGTATTTCAGGAAGTGGG 0: 1
1: 0
2: 0
3: 22
4: 262
1120526867_1120526870 -9 Left 1120526867 14:85587189-85587211 CCAGCACTTACATTCTTTTAGTA 0: 1
1: 0
2: 0
3: 14
4: 202
Right 1120526870 14:85587203-85587225 CTTTTAGTATTTCAGGAAGTGGG 0: 1
1: 0
2: 0
3: 22
4: 262
1120526865_1120526870 18 Left 1120526865 14:85587162-85587184 CCTTGAAAACCTACACACATACA 0: 1
1: 0
2: 5
3: 60
4: 1069
Right 1120526870 14:85587203-85587225 CTTTTAGTATTTCAGGAAGTGGG 0: 1
1: 0
2: 0
3: 22
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120526870 Original CRISPR CTTTTAGTATTTCAGGAAGT GGG Intronic
902887764 1:19418557-19418579 TTCATAGTAATTCAGGAAGTGGG - Intronic
904902653 1:33869589-33869611 GATTTAGTATTTCTGGGAGTTGG + Intronic
905899862 1:41574379-41574401 CTATTGGTATTTTAGGCAGTAGG + Intronic
906184979 1:43855302-43855324 CTTTTAGGATTTCAGCATTTGGG - Intronic
906419786 1:45655698-45655720 GTTTTAGTATTTCTGGAATAAGG + Intronic
907621429 1:55984914-55984936 CATGTGGGATTTCAGGAAGTAGG - Intergenic
909262696 1:73513632-73513654 CTATGAATATTTCAGGTAGTAGG + Intergenic
909262823 1:73515915-73515937 CTATGAATATTTCAGGTAGTAGG - Intergenic
910756710 1:90701540-90701562 CTTTTATTCTTTAATGAAGTTGG - Intergenic
911640485 1:100283346-100283368 TTTTTAGTATTTCACCATGTTGG + Intronic
911743389 1:101411832-101411854 CTTTTTTTATTTCATTAAGTTGG - Intergenic
913372168 1:118111838-118111860 ATTATAGTATATCAGGAAATAGG + Intronic
914884745 1:151575634-151575656 CTTCTAGAACTTCAGGAATTTGG + Intronic
915343122 1:155186982-155187004 CTTTTAGGAATTCTGGCAGTGGG + Intronic
915463751 1:156083892-156083914 CTTTTAGAGTTTCAGGAAGGTGG + Intronic
918421403 1:184367553-184367575 CTGTAAGTATTTCAGGCACTGGG - Intergenic
918448470 1:184636687-184636709 CTTTTGGTATTTCAGTAAACTGG - Intergenic
918741641 1:188139395-188139417 TTTTTAGTATTCCAGGAAAAAGG - Intergenic
919219071 1:194601785-194601807 TTTTTAGTATTTCACCATGTTGG + Intergenic
919232033 1:194785897-194785919 CTTTTAATATTTCACTAAGGAGG + Intergenic
919359992 1:196580211-196580233 CATTTAGTATTTCTGGAGCTGGG - Intronic
919629050 1:199942119-199942141 CTTGTGGTTTTTGAGGAAGTTGG - Intergenic
922083413 1:222321234-222321256 CTTTTAGTATTTCGTTTAGTAGG - Intergenic
922870823 1:228900517-228900539 CTTTTATCACTTCAGGAAGCTGG - Intergenic
924901188 1:248402101-248402123 TGTTTAGTATTTCAAAAAGTTGG - Intergenic
1063174205 10:3536871-3536893 CTTTTGATATATCAGGAAATAGG - Intergenic
1064927916 10:20590454-20590476 CTTTGAGTAGATGAGGAAGTGGG - Intergenic
1065340645 10:24701562-24701584 ATGAAAGTATTTCAGGAAGTGGG + Intronic
1065464391 10:26003485-26003507 CTTTTAGTTTTTTATTAAGTGGG + Intronic
1065650972 10:27890812-27890834 CTTTTAGGATTTTAGGATCTGGG + Intronic
1068433796 10:56965484-56965506 CTTTTAGTATATCTTGAAATTGG - Intergenic
1068442183 10:57071868-57071890 TTTTTACTATTTCAGGTATTAGG + Intergenic
1068912932 10:62398037-62398059 CTTTTAGTTATTCAAGGAGTGGG - Intronic
1068940897 10:62680135-62680157 ATTTTTGTGTTTCAGGAAATAGG + Intergenic
1070038389 10:72750560-72750582 CTTTTACATTTTCAAGAAGTAGG + Intronic
1071669410 10:87594194-87594216 CTTAAAGTAATTCAGGAGGTAGG - Intergenic
1072680494 10:97502560-97502582 CTTTCAATATTTCAGAAAGGGGG + Intronic
1073802602 10:107058536-107058558 GTCTTACTATCTCAGGAAGTAGG + Intronic
1073825163 10:107312546-107312568 CATTTATTATTTAAGGTAGTTGG - Intergenic
1074788836 10:116865866-116865888 TTATTAGTATTCCAGGAAGAGGG - Intronic
1081130559 11:39373790-39373812 GTTTTAGTAATTCAGGGAGATGG + Intergenic
1081690955 11:45078146-45078168 CTCTTAGGATTTTTGGAAGTGGG + Intergenic
1083017821 11:59474716-59474738 CTTCTAGTATTACATGGAGTGGG - Intergenic
1084011677 11:66353678-66353700 ATTTTTGTGTTTCAGGAAATAGG - Intronic
1086750113 11:90482282-90482304 CTTTTAGTCAGTCAGGAAGATGG + Intergenic
1087033435 11:93729808-93729830 CTTTAAACATTTCAGGGAGTTGG - Intronic
1087613304 11:100459832-100459854 TTTTTAATAATTCAGGAAATCGG + Intergenic
1088352038 11:108900426-108900448 CTTTAAGTATTTTAGAAAGGTGG - Intronic
1088580383 11:111310118-111310140 CTTTGTGTATATGAGGAAGTTGG - Intergenic
1088782997 11:113154464-113154486 CTTTTACTATTTCAGAAAAAGGG - Intronic
1089176379 11:116551784-116551806 CTTTTTGTCTTCCAAGAAGTGGG - Intergenic
1089237406 11:117042693-117042715 CTTTTAGCATTTTAGCCAGTTGG - Intronic
1092823996 12:12380008-12380030 ATTATTGTATTTCAGGGAGTAGG + Intronic
1093113665 12:15182963-15182985 CTTTTAGCCTTTCAGGAGCTGGG - Intronic
1093936230 12:25003559-25003581 CTTATAGTAATTCAGAAATTTGG - Intergenic
1094008389 12:25780656-25780678 CTTGTAGTCTTTCTGGAAGTGGG + Intergenic
1095726342 12:45457130-45457152 ATTTTTGTAATTCAGGAAATAGG - Intergenic
1095872487 12:47045343-47045365 ATTTTTGTATTTCAGGCAATTGG - Intergenic
1097148105 12:56955389-56955411 CTTATTGTCTTTCAGGCAGTAGG - Intronic
1098314176 12:69176174-69176196 GTTTTAGTGTTTTAGTAAGTGGG - Intergenic
1098478530 12:70934905-70934927 GTTTTAGCATTTTAGCAAGTTGG - Intergenic
1099371150 12:81832189-81832211 ATTTTCATATTGCAGGAAGTAGG + Intergenic
1099517476 12:83615286-83615308 GTTTTAGTCTGTCAGGGAGTTGG + Intergenic
1101133553 12:101714497-101714519 CTTTCAGTATTTATGGCAGTGGG + Exonic
1101770076 12:107741371-107741393 ATTTTAGTTTTATAGGAAGTGGG - Intronic
1102845761 12:116180666-116180688 CTTTTAGTAGTTGAGGAGGGCGG - Intronic
1103337032 12:120197315-120197337 CTTTTACCTTTTCAGCAAGTGGG + Exonic
1108116071 13:47129482-47129504 CTTTAAGTATTTCAGGATGCTGG - Intergenic
1108453669 13:50591509-50591531 TATTTATTATTTCAGGAAATAGG - Intronic
1109305006 13:60628740-60628762 ATTTTATTATTCCAGGAAGCAGG + Intergenic
1109760081 13:66816597-66816619 CTTTTGGTATTTCAAAAATTAGG + Intronic
1109802091 13:67393787-67393809 CTTTTTTTATTTCTGGAAGAGGG + Intergenic
1109893576 13:68652557-68652579 ATTTTAGTTTTACAGGAATTTGG + Intergenic
1111524011 13:89443857-89443879 CTTTAAGTTTTTCTGGATGTGGG - Intergenic
1112096623 13:96139513-96139535 CTTACAGTATTTCAGGAAAAGGG - Intronic
1112270776 13:97967482-97967504 TCTTTAGTATCTAAGGAAGTAGG + Intronic
1112631991 13:101172044-101172066 TTTTTAATACTTCAGGAAGCTGG - Intronic
1114500975 14:23168317-23168339 CTTGTAGTATTCCAGGACTTTGG + Intronic
1116152673 14:41161566-41161588 CTTTTCCTATTACAAGAAGTAGG + Intergenic
1116577480 14:46592969-46592991 ATTTTAGTATTCCAAGAAATAGG + Intergenic
1116928220 14:50663464-50663486 CTTTTAGTTTTTAAGGAATTAGG - Intronic
1117332753 14:54729521-54729543 ATTTTATTATTTCACCAAGTAGG - Intronic
1118072123 14:62256829-62256851 CTTTTAGGATCTCAGGGAGCAGG + Intergenic
1118953950 14:70462377-70462399 CATTTAGTATAACAGGAACTGGG + Intergenic
1120066949 14:80053520-80053542 CTTCAAATATTTCAGGAGGTTGG - Intergenic
1120526870 14:85587203-85587225 CTTTTAGTATTTCAGGAAGTGGG + Intronic
1120914491 14:89698752-89698774 ATTTTAGGATTTCAGGATGATGG + Intergenic
1121998008 14:98620436-98620458 ATTTTTGTATCTCAGGGAGTAGG - Intergenic
1125666577 15:41435572-41435594 ATTTCAGTCTTTCAGGAAGTTGG + Intronic
1126982914 15:54266597-54266619 CTTCCAGTTTTTCAGGAAGCTGG + Intronic
1127198930 15:56621890-56621912 ATATTAGTATGTCAGGAATTGGG - Intergenic
1130028033 15:80286559-80286581 CTTTCACTATTCCTGGAAGTAGG + Intergenic
1131632701 15:94196037-94196059 CATTTACTATAACAGGAAGTAGG + Intergenic
1133501859 16:6373888-6373910 CTTTTTGTCTTTCAGATAGTAGG + Intronic
1133674427 16:8057222-8057244 CTTTTGGTGTTTTAGGAAGAGGG - Intergenic
1135664017 16:24320488-24320510 CTTTTTGGATTTCAGGAGCTTGG + Intronic
1137316786 16:47333619-47333641 CTTTTATAAGTTCATGAAGTTGG + Intronic
1139363576 16:66419067-66419089 TTTTTAGTATTTCACTATGTTGG - Intergenic
1139696505 16:68678944-68678966 CTTTTAGCATTTAAGGGTGTGGG - Intronic
1140115234 16:72036069-72036091 CTTTTTGTTTCTCAGGAAGGGGG - Intergenic
1140278313 16:73530956-73530978 CTTTTAGGTTTTCAGCATGTTGG - Intergenic
1140612275 16:76614803-76614825 ATTTTAATATTTCAGGAAAGTGG + Intronic
1141481569 16:84310016-84310038 CATTTAGGATTCCAGGGAGTAGG + Intronic
1141914940 16:87089241-87089263 CTTTTCGTATTTTACAAAGTTGG + Intronic
1146127277 17:30239172-30239194 CTTTGAGACTTCCAGGAAGTGGG - Intergenic
1146539452 17:33681664-33681686 ATTTCAGGATTTCAGGAAGCAGG - Intronic
1146935495 17:36810191-36810213 TTTTTAGTATTTCACCATGTTGG - Intergenic
1147011267 17:37450519-37450541 CTTAAAATATTTCAAGAAGTGGG - Intronic
1150868936 17:68883247-68883269 CTTTTGCTATTACAGAAAGTTGG - Intronic
1151394394 17:73812516-73812538 ATTTTAGTATTCCAGAAATTGGG + Intergenic
1153456992 18:5293994-5294016 CTTTTTGTTTTTCAGGATATGGG - Exonic
1155210823 18:23599883-23599905 CTTTTAGTAACTCTGAAAGTTGG + Exonic
1156927444 18:42598638-42598660 ATTCCAGTATATCAGGAAGTTGG + Intergenic
1158060213 18:53331588-53331610 ATCTCAGTATTTCAGGAAGTTGG + Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158899142 18:61946453-61946475 GTTTTTGTATTTCAGTAAGTGGG - Intergenic
1159534801 18:69702577-69702599 ATTTTAGTATTTCTGAAATTGGG - Intronic
1160970920 19:1767443-1767465 CTTTTAGAAAGGCAGGAAGTGGG + Intronic
1162836252 19:13320124-13320146 CTTTGAGAGTTTCAGGAACTAGG - Intronic
1164966152 19:32486452-32486474 TCTTTAGTAATTCAGGAAGATGG + Intergenic
1166843859 19:45714375-45714397 CTTTTTTTTTTTCAGGTAGTGGG + Intronic
926776309 2:16426643-16426665 CTTTTCAAATGTCAGGAAGTTGG - Intergenic
929024775 2:37589366-37589388 CTTTTAGATTTTTAGGTAGTTGG + Intergenic
929289448 2:40172589-40172611 CTTTTAATATCTCAGGTAATGGG - Intronic
929821727 2:45279653-45279675 CTTTCAGTTTTCCAGGAAGGTGG - Intergenic
929886189 2:45880851-45880873 CTTTTAAGATTTCAGGGTGTAGG + Intronic
929977388 2:46648173-46648195 CTTTTAGTATTCCAGTCTGTGGG + Intergenic
930257630 2:49110224-49110246 CTCTCAGTATTCCATGAAGTAGG + Intronic
931201277 2:60099776-60099798 TTATTAGTATTGCAGGAGGTAGG - Intergenic
931619100 2:64191993-64192015 CTTTTAATTCTTCAGGAAATTGG - Intergenic
932016530 2:68033549-68033571 CTCTTTGTCTTTTAGGAAGTTGG + Intergenic
933031615 2:77335433-77335455 GTGTTAGCATTTCAGGCAGTGGG - Intronic
933373985 2:81455322-81455344 ATGTAAGTATTTCAGGCAGTAGG + Intergenic
933384517 2:81592989-81593011 CTTTTTGTATTTCAGTGAATAGG + Intergenic
935608592 2:104996907-104996929 CTCTTTGTGTTTCAGGAAGGGGG - Intergenic
936949151 2:117959815-117959837 CTTTTAGGATTTCTGGGAATTGG + Intronic
938773092 2:134517707-134517729 GTTTTAGTATGTCAGGATCTTGG - Intronic
939980826 2:148778636-148778658 CCTTTATTATTTCAGGGAGGAGG - Intronic
940770749 2:157837061-157837083 CTTTATGTATATTAGGAAGTAGG - Intronic
941235341 2:162964930-162964952 CTTTTAGTATTTAGGCAATTTGG - Intergenic
942917296 2:181326668-181326690 CTTTTAGAATTTCAGCGTGTGGG + Intergenic
943089000 2:183351870-183351892 TTTTTAGTATTTCACCATGTTGG - Intergenic
945527658 2:210908491-210908513 GTTTATGTATTTCAAGAAGTTGG - Intergenic
948173799 2:235927870-235927892 CTTTTTGTTTTTCAGGTATTTGG + Intronic
1169705409 20:8498265-8498287 TTTTTTGTATTTCAGTAAGATGG + Intronic
1170249259 20:14262196-14262218 CTTTTAATCTTGCAGGTAGTGGG + Intronic
1171006794 20:21474187-21474209 CTATTAATATTACAGGAAGAAGG - Intergenic
1174717776 20:52778281-52778303 CTTTAAATATTTCTGGAAGAAGG - Intergenic
1175640568 20:60626329-60626351 CTTTTAGCATTTCAGTAAAGTGG - Intergenic
1175897281 20:62344295-62344317 TTTTTAGTGTTTCTGGAATTGGG - Intronic
1177934842 21:27332098-27332120 CTTGGAGCATTTCTGGAAGTAGG + Intergenic
1179125898 21:38590299-38590321 CACTTAGCATTTCAGTAAGTGGG + Intronic
1180734785 22:18008052-18008074 ATTTTAGTATTTCACCATGTTGG - Intronic
1182700680 22:32235078-32235100 TTTTTAGCATTTAACGAAGTTGG - Exonic
949380937 3:3445017-3445039 CTTTTTGTATCTCAGGAGGCTGG - Intergenic
951056103 3:18148204-18148226 TTTTAAATATTTGAGGAAGTGGG - Intronic
951138091 3:19127546-19127568 CCTTTAGTGTTTAAGCAAGTTGG + Intergenic
953185400 3:40632551-40632573 CTTTTTTTATTTCATTAAGTTGG - Intergenic
953229421 3:41051414-41051436 ATTTTAGTCTCCCAGGAAGTAGG + Intergenic
953451542 3:43010548-43010570 CTTTTCGTATTTCATGAGGGTGG + Intronic
954719888 3:52552626-52552648 AATTTAGGATTTCAGGAAGGTGG + Intronic
954803969 3:53204561-53204583 GTTTTAGTTTTTCAGGCAGGAGG - Intergenic
955322601 3:57985083-57985105 TTTTTAGTATTTCACTATGTTGG + Intergenic
955560411 3:60182999-60183021 TTTTTATTCTTTCAGGAAATGGG - Intronic
956326271 3:68056322-68056344 CTTGTAGCTTTTCAGGATGTGGG - Intronic
957340404 3:78888778-78888800 TTTTTAGTATTTTTGGAGGTTGG - Intronic
958584821 3:96072987-96073009 CATTTGGTATTTCTGGAAATTGG - Intergenic
959364320 3:105437408-105437430 CATATAGTATTTCAGAAATTGGG - Intronic
960490224 3:118308427-118308449 CATGTGGTAATTCAGGAAGTTGG + Intergenic
960900275 3:122547679-122547701 CTTTTATTTTTTGTGGAAGTGGG - Intronic
961079459 3:124013573-124013595 GTTTGATTATTTCAGGAAGTTGG - Intergenic
962343463 3:134603591-134603613 CACTTTGTATTTCAGGATGTAGG + Exonic
962500201 3:135983421-135983443 GTTATAGTTTTTCAGGAAGGGGG - Intronic
962532943 3:136300649-136300671 CTTTTAATGTTCCAGGAAGTTGG + Intronic
964244408 3:154634084-154634106 CTTATAGTATTGTTGGAAGTTGG + Intergenic
964251917 3:154727828-154727850 TTGCTAATATTTCAGGAAGTGGG - Intergenic
965222775 3:165949399-165949421 CTTTTTAAATTTCAGGAATTAGG - Intergenic
966789083 3:183648532-183648554 CTTGAAATATTTCAAGAAGTTGG + Intronic
967346213 3:188458872-188458894 CTTTTTTTTTTTCTGGAAGTAGG + Intronic
970947717 4:21714605-21714627 CTTTTAGTAGGTCAAGAAGTAGG + Intronic
971260086 4:25048586-25048608 CTTATAGTATATCTTGAAGTCGG + Intergenic
972347615 4:38206052-38206074 CTTCTAGTATTTCAGAAGGTTGG + Intergenic
975299079 4:72768240-72768262 ATTTTCGTATTTCTGGCAGTAGG - Intergenic
976106148 4:81619791-81619813 AATTTGGTATTTCAGAAAGTTGG - Intronic
978395503 4:108275260-108275282 TTTATAGTATTTGAAGAAGTTGG + Intergenic
979031922 4:115659349-115659371 CATTTAGTATTTCAAGAATACGG - Intergenic
979368566 4:119855396-119855418 CTTTTAATAATTAAGGAAATGGG - Intergenic
980645722 4:135640136-135640158 CTTGGAGTATTTCAGGATCTTGG - Intergenic
981366464 4:143909809-143909831 CTTTTAGTTTTTAAGGAATTAGG - Intergenic
982929449 4:161384563-161384585 CTTTTAGGATTACAAGAAGATGG + Exonic
983118184 4:163846263-163846285 CTTTTAGTCTCTGAGCAAGTGGG - Intronic
983613277 4:169673750-169673772 ATATTAATATTTCAGGAATTGGG - Intronic
984585582 4:181560632-181560654 ATTTTTGTGCTTCAGGAAGTAGG + Intergenic
985236345 4:187879035-187879057 CATTCAGTGTTTCTGGAAGTTGG - Intergenic
986270402 5:6225279-6225301 CATTTCTTATTTCAGGAAGGAGG + Intergenic
987107956 5:14659494-14659516 ATGTTAGTAATACAGGAAGTTGG - Intergenic
987778194 5:22396751-22396773 GTTTCAGCATTTCAGCAAGTTGG + Intronic
988062339 5:26187733-26187755 CTGTTTGTATTTCAGTAAATTGG + Intergenic
988926372 5:35994762-35994784 CTTTTTGGATTTCACCAAGTTGG - Intergenic
989307731 5:39977048-39977070 ATTTCAGTATTTCACAAAGTAGG + Intergenic
992963070 5:81974610-81974632 CTTTTGGTTTTTTAAGAAGTGGG + Intronic
995205591 5:109476085-109476107 CTTTTAGAATTTCAAGGGGTAGG - Intergenic
995223202 5:109674374-109674396 CTTTTTGTATGTCAGAAATTGGG + Intergenic
995249962 5:109982206-109982228 CCTTCAGTGTTTCAGGAAATAGG - Intergenic
996263046 5:121497974-121497996 GTTTTTGTAAGTCAGGAAGTTGG - Intergenic
996389630 5:122945778-122945800 CTTTTAATTTTTCAGGAAAAAGG + Intronic
996874645 5:128227355-128227377 GTCTTAGTCTTTCAGGAAGTAGG + Intergenic
999011516 5:148046588-148046610 TTTTTAGTATTTTAGGCAGTTGG - Intronic
999518678 5:152327451-152327473 TTTATAGTTTTTCATGAAGTGGG - Intergenic
1001581581 5:172802125-172802147 GTTTTAGATTTTCAGGAATTTGG + Intergenic
1002407078 5:179043387-179043409 CTTTTAGTCTATAAGAAAGTGGG - Intergenic
1003092113 6:3112978-3113000 TTTTTAGCAATTCAGGAAGCTGG + Intronic
1004758858 6:18643609-18643631 TTTTTATGATTTAAGGAAGTGGG + Intergenic
1004817572 6:19329180-19329202 CTTCTAATATTTCTCGAAGTTGG - Intergenic
1004974896 6:20953799-20953821 GGTTTATTATTTCTGGAAGTAGG + Intronic
1005409432 6:25527169-25527191 CCTTTGGTCCTTCAGGAAGTGGG + Intronic
1009919572 6:70040555-70040577 CCTTTATTATTTCAGGAAATGGG + Intronic
1010005834 6:70993986-70994008 ATTTTAGTCATTCAGGAAGATGG - Intergenic
1010741889 6:79516527-79516549 GTTTTAGGATGTCAGAAAGTTGG - Intronic
1010986204 6:82427338-82427360 TTTTTAGTTTTTCAGGAAGCTGG + Intergenic
1013219969 6:108069777-108069799 CTTTTAGAATTTCTGGGAGAGGG - Intronic
1014050267 6:116944676-116944698 CTATTAGCATGTCTGGAAGTTGG + Intergenic
1014174999 6:118322586-118322608 CTTTGAGCATTTCAGGAAAATGG + Intergenic
1014193356 6:118523860-118523882 CTATCAGGATTTCAGTAAGTGGG - Exonic
1015035573 6:128650221-128650243 CTTTGAGTATCTCAGGCAGCAGG - Intergenic
1016926374 6:149353148-149353170 GTTTTAGAATTTCTGGATGTAGG - Intronic
1017239389 6:152150151-152150173 CTTTTATTATTTCAGAACATAGG + Intronic
1017719469 6:157234924-157234946 CTTGTAGTGATGCAGGAAGTGGG + Intergenic
1018037375 6:159893123-159893145 CTTTGAGTTTTGCAGGAAGGTGG + Intergenic
1018146219 6:160891838-160891860 CATTTTGTATTATAGGAAGTTGG - Intergenic
1020490297 7:8774309-8774331 CTTATAGTATAGCTGGAAGTAGG + Intergenic
1022896276 7:34752975-34752997 ATTCTAGTGTTTCAGGGAGTTGG - Intronic
1023954928 7:44877500-44877522 CTTTTAGAAATTCAGAGAGTAGG + Exonic
1024421376 7:49170886-49170908 GTTTTAGTCTATCAGGAAGATGG + Intergenic
1026364556 7:69634690-69634712 CTTTAAGTATTTCGGGAAGAGGG + Intronic
1028166516 7:87543876-87543898 CATTGACTATTTCAGGAAGCTGG + Intronic
1028814828 7:95131649-95131671 TTTTTTGTCTTTCAGGAGGTAGG + Intronic
1029918998 7:104242288-104242310 CTTTTAGTCTTTTGAGAAGTAGG + Intergenic
1031873070 7:127108533-127108555 CTCTTAGTAGCTCAGGAAGTGGG - Intronic
1032681169 7:134185026-134185048 CTTTTGGTATTTCAGGAGGAAGG + Intronic
1032834584 7:135661561-135661583 TTTCTTGTTTTTCAGGAAGTTGG + Intergenic
1035108492 7:156461434-156461456 CTCTTACTCTTTCAGGAAGCAGG + Intergenic
1038142422 8:24860952-24860974 CATTGATGATTTCAGGAAGTAGG - Intergenic
1038921807 8:32093030-32093052 ATTTTAGTCTTTAAGGATGTGGG + Intronic
1040597162 8:48849878-48849900 CTTGTAGTTTTTCAGGATGTGGG - Intergenic
1040794613 8:51275097-51275119 CTTTTAGTCTGTCAGGAAGATGG + Intergenic
1041706009 8:60846954-60846976 CTTTTGGTATCTCAGAAACTTGG + Intronic
1042700959 8:71613887-71613909 CTTGTGGTGTTTCAGGAAGAAGG - Intergenic
1042712972 8:71738741-71738763 CTTTTAGTATTTCAAAAACAGGG + Intergenic
1042852699 8:73232302-73232324 GTTTTAGTAGTTCAGGGAGATGG + Intergenic
1043245382 8:77993296-77993318 CTTTATGTATTTCAGGAAATAGG + Intergenic
1043626584 8:82268312-82268334 CTTTTATTATTTCAACAAGAAGG - Intergenic
1044111833 8:88285070-88285092 TTTATAGTATGTCAGGAAGATGG - Intronic
1044342407 8:91061768-91061790 CTTATGGTATTTCAAGAAATAGG + Intergenic
1044507983 8:93042625-93042647 CTTTTAGGAATTCAGGGATTGGG + Intergenic
1044542386 8:93422367-93422389 CTTAGAATATGTCAGGAAGTGGG + Intergenic
1044563616 8:93638725-93638747 CTTCTGGTATTTCAAGAATTAGG - Intergenic
1045334938 8:101192402-101192424 CTTTTAGTATTTCATCATATTGG + Intronic
1050066585 9:1766253-1766275 ATTATAGAATTTGAGGAAGTGGG - Intergenic
1051103233 9:13547147-13547169 CTTATAACATTTCTGGAAGTCGG - Intergenic
1052760090 9:32581404-32581426 CATTTAGTATTTCTTGAATTTGG + Intergenic
1052792812 9:32891899-32891921 ATTTCAGGATTTCATGAAGTTGG - Intergenic
1053181484 9:35975223-35975245 CAGTTAATATTTCAGTAAGTAGG + Intergenic
1055093058 9:72382361-72382383 CTATTTGTATTTCAGGGAGCAGG - Intergenic
1056151180 9:83790594-83790616 TTTTTAGTATTTCACCATGTTGG - Intronic
1056860897 9:90180697-90180719 ATTTTAGTTGTTCAGGAAGATGG + Intergenic
1058501105 9:105618042-105618064 ATTTTAGCATTTCAGGATGCAGG + Exonic
1058728275 9:107824396-107824418 CTTTTAATTTTACAGGGAGTTGG + Intergenic
1059011333 9:110464880-110464902 TTTTTGGAATTTCTGGAAGTAGG + Intronic
1059785100 9:117573552-117573574 TTTTTAGTATTTCACTATGTTGG - Intergenic
1061344559 9:130012289-130012311 CTTTTAGTAACTCAGTGAGTAGG - Intronic
1185766483 X:2729774-2729796 CTTTTTTTATTGCAGGAGGTGGG + Intronic
1187659834 X:21531433-21531455 CTTTTAGTGTTTAAGACAGTAGG - Intronic
1188241256 X:27794455-27794477 CTTTTAGAACTTTAAGAAGTTGG + Intergenic
1194076065 X:89395536-89395558 CTTGTAGTATTTTTTGAAGTTGG + Intergenic
1195543489 X:106088813-106088835 CTTTTGGTTTTTCAGGAAAAGGG - Intergenic
1197122873 X:122913044-122913066 ATTTTAGTGTTTCTGGACGTTGG - Intergenic
1199103263 X:143831758-143831780 CTTTTTGTATTGCAGGGTGTTGG + Intergenic
1200428705 Y:3051049-3051071 CTTGTAGTATTTTTTGAAGTTGG + Intergenic
1201859858 Y:18584916-18584938 CTTTAAGTATTCCAGGGAGATGG - Intronic
1201873463 Y:18735465-18735487 CTTTAAGTATTCCAGGGAGATGG + Intronic
1202167217 Y:22002720-22002742 GTTTAAGTATTTCAGGGAGATGG + Intergenic
1202224142 Y:22583649-22583671 GTTTAAGTATTTCAGGGAGATGG - Intergenic
1202318972 Y:23612011-23612033 GTTTAAGTATTTCAGGGAGATGG + Intergenic
1202551797 Y:26058046-26058068 GTTTAAGTATTTCAGGGAGATGG - Intergenic