ID: 1120528152

View in Genome Browser
Species Human (GRCh38)
Location 14:85601476-85601498
Sequence CTGTCCTAGCAGCTGGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 204}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120528149_1120528152 2 Left 1120528149 14:85601451-85601473 CCTCTGGATAATGGAAGACAGCA 0: 1
1: 0
2: 2
3: 23
4: 223
Right 1120528152 14:85601476-85601498 CTGTCCTAGCAGCTGGTGAATGG 0: 1
1: 0
2: 1
3: 23
4: 204
1120528145_1120528152 19 Left 1120528145 14:85601434-85601456 CCTGGGGAGGCCACAGGCCTCTG 0: 1
1: 0
2: 0
3: 55
4: 480
Right 1120528152 14:85601476-85601498 CTGTCCTAGCAGCTGGTGAATGG 0: 1
1: 0
2: 1
3: 23
4: 204
1120528148_1120528152 9 Left 1120528148 14:85601444-85601466 CCACAGGCCTCTGGATAATGGAA 0: 1
1: 0
2: 1
3: 13
4: 146
Right 1120528152 14:85601476-85601498 CTGTCCTAGCAGCTGGTGAATGG 0: 1
1: 0
2: 1
3: 23
4: 204
1120528144_1120528152 20 Left 1120528144 14:85601433-85601455 CCCTGGGGAGGCCACAGGCCTCT 0: 1
1: 0
2: 1
3: 34
4: 357
Right 1120528152 14:85601476-85601498 CTGTCCTAGCAGCTGGTGAATGG 0: 1
1: 0
2: 1
3: 23
4: 204
1120528142_1120528152 26 Left 1120528142 14:85601427-85601449 CCAGTTCCCTGGGGAGGCCACAG 0: 1
1: 0
2: 0
3: 68
4: 544
Right 1120528152 14:85601476-85601498 CTGTCCTAGCAGCTGGTGAATGG 0: 1
1: 0
2: 1
3: 23
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120528152 Original CRISPR CTGTCCTAGCAGCTGGTGAA TGG Intronic
900364724 1:2306435-2306457 GTGTCCTAGCAGGTGGAGGAGGG + Intronic
900931340 1:5739778-5739800 CTCTCCTATTAGCTGGCGAATGG - Intergenic
901343623 1:8518309-8518331 CTGTCCCAGCACCTTGGGAATGG - Intronic
901870001 1:12132947-12132969 CTGTCCTCCCAGCTGGAAAATGG - Intronic
902140193 1:14347152-14347174 CTATCCCAGCAACTTGTGAAGGG + Intergenic
902653576 1:17852561-17852583 CAGGCCTAGCACCTGCTGAAAGG + Intergenic
902660243 1:17895928-17895950 CTGACCTGGCTGCTGGTGAGTGG + Intergenic
902720077 1:18298181-18298203 GTGCCCTAGAAGCTGCTGAAGGG + Intronic
902963309 1:19979761-19979783 CTGTCCTGCCAGCTGATGAGGGG - Intronic
903195274 1:21682009-21682031 ATGCCCTAGAAGATGGTGAAGGG - Intronic
903270175 1:22183220-22183242 CGATCTTAGCAACTGGTGAATGG - Intergenic
903496732 1:23773645-23773667 CTGTACTAGAAGGTGGTGAGAGG + Intergenic
906526851 1:46498539-46498561 CTGACCTAGCAGCAGGGGACAGG + Intergenic
906707480 1:47905338-47905360 CCGTCCTGGCAGCTGGGGATGGG + Intronic
911102334 1:94104584-94104606 CTGTCCATGCAGCTGGGGCAGGG + Intronic
913975266 1:143450579-143450601 CTATACCAGCAGCTGGTGCAGGG - Intergenic
914069659 1:144276195-144276217 CTGTACCAGCAGCTGGCGCAGGG - Intergenic
914109496 1:144690159-144690181 CTGTACCAGCAGCTGGCGCAGGG + Intergenic
914883424 1:151565432-151565454 GTGGCCCAGCAGCTGGTGCAAGG + Intronic
916238434 1:162614004-162614026 GTGTCCTACCAGCAGATGAAGGG + Intergenic
917723737 1:177810982-177811004 CTCTCCTGGCAGAAGGTGAAGGG + Intergenic
920295973 1:204956656-204956678 CTGTGCTAGGTGCTGGTGAAAGG - Intronic
921152596 1:212414238-212414260 CTGTCCCCGCGGCTGGTGACAGG - Intronic
924781634 1:247154371-247154393 CAGTCCTGGCAGAAGGTGAAGGG - Intronic
1064206145 10:13325534-13325556 CAGTCGTGGCAGATGGTGAAGGG - Intronic
1072331800 10:94361319-94361341 CTTACCTAACTGCTGGTGAATGG + Intronic
1073440911 10:103552189-103552211 CTGTCCTATCTGGTTGTGAAGGG - Intronic
1075177697 10:120181334-120181356 CTGGCCTGGCAGGGGGTGAACGG - Intergenic
1076992189 11:281259-281281 CTGTCCTACCTGCTGGAGGACGG + Exonic
1078612202 11:12830423-12830445 CTCTCCTACCAGCTCCTGAAGGG + Intronic
1079631066 11:22676134-22676156 CTGACCTATCTGTTGGTGAAGGG - Intronic
1081355810 11:42111922-42111944 CTATTCTATCAGCTGGTGACAGG + Intergenic
1082955242 11:58863661-58863683 CTGGCCTAGAAGCTGGGGAATGG + Intronic
1083540418 11:63508270-63508292 GTGTCCTAGGAGCTGGGGAAAGG + Intronic
1084549579 11:69833153-69833175 CTGTCCCAGCTGCTGGTGCACGG + Intergenic
1084732856 11:71084547-71084569 CTGTTCTAGCACCTGGAGAATGG - Intronic
1089498936 11:118921836-118921858 CTGTGCTAGCTGGTGGGGAAGGG - Intronic
1089581788 11:119485938-119485960 CTGTCCTCGCTGCTGGTAGAGGG + Intergenic
1089721276 11:120425202-120425224 CTTTGCTAGCAGGTGGTGATGGG + Intronic
1091517414 12:1198722-1198744 CAGTCATAGCAGAAGGTGAAGGG + Intronic
1091580702 12:1786941-1786963 CACTCCTAGCAGCTGGTAAAGGG + Exonic
1095641311 12:44488553-44488575 CTGCTCTAGCAGATGGTGGAGGG - Intergenic
1096555477 12:52400990-52401012 CTGCCCGAGCAGCTGGAGATGGG - Intronic
1100864484 12:98842173-98842195 ATGTCCGATCAACTGGTGAATGG + Intronic
1100881449 12:99022260-99022282 CTCTCCAACCAGCTGGTAAATGG - Intronic
1102440959 12:112963534-112963556 CACTCCTAGCAGCTGGGGATGGG - Intronic
1103010849 12:117457119-117457141 CTGTCCGTGCAGACGGTGAAAGG + Exonic
1103437364 12:120937244-120937266 CACTCCTAGCAGCTGGGGAATGG - Intergenic
1104021975 12:124998368-124998390 ATGTCTTATCAGCTGATGAAGGG + Intronic
1104559964 12:129834545-129834567 CAGTGCTAGCAGCTGGTGCATGG - Intronic
1105847505 13:24306448-24306470 CTGGCCTGTGAGCTGGTGAAAGG - Exonic
1106358249 13:29005310-29005332 CTGGCCCAGCAGCTGGAGAGGGG + Intronic
1108564030 13:51676418-51676440 CTGTACCTCCAGCTGGTGAAGGG + Intronic
1113829922 13:113287680-113287702 CTATTCTAGCAGCTGGTCCAGGG + Intergenic
1117574135 14:57081279-57081301 ATCTCCGAGAAGCTGGTGAAAGG + Intergenic
1119196477 14:72720498-72720520 CTGGCCAAGCAGCAGCTGAATGG - Intronic
1119423113 14:74519703-74519725 CAGCCCCAGCAGCTGGGGAACGG - Intronic
1120528152 14:85601476-85601498 CTGTCCTAGCAGCTGGTGAATGG + Intronic
1120598983 14:86476921-86476943 CTATCCTAGCAGCCTTTGAAAGG + Intergenic
1120813712 14:88831179-88831201 CTGTCATGGCAGCTGGTGGGAGG - Intronic
1122365571 14:101193117-101193139 CTTTCCTAGCAGATGGGGAAAGG - Intergenic
1122551858 14:102554824-102554846 CTTTTCTTTCAGCTGGTGAAAGG + Intergenic
1123088089 14:105727372-105727394 CAGTCATAGCAGAAGGTGAAGGG - Intergenic
1123094044 14:105756745-105756767 CAGTCATAGCAGAAGGTGAAGGG - Intergenic
1126807000 15:52360973-52360995 CTTTTCCAGCAGCTGGGGAAAGG - Intronic
1127070266 15:55282024-55282046 CTGTGCCAGCTGCTGGTTAAAGG - Intronic
1127617004 15:60696198-60696220 CTGTCCTATCAGCTCGCTAATGG + Intronic
1128522986 15:68387719-68387741 CTCTCCTAGAAGCAGCTGAAGGG - Intronic
1128549282 15:68587577-68587599 GGGGCCTAGCACCTGGTGAAAGG - Intronic
1133712634 16:8415987-8416009 CTGTTGTCGCAGCTGGTGGATGG - Intergenic
1135490017 16:22900951-22900973 CTGTCGCAGGAGCAGGTGAAGGG + Intronic
1135704445 16:24662670-24662692 CAGTGCAAGCAGGTGGTGAAGGG + Intergenic
1138192955 16:55031598-55031620 CTGTCATAGCACTTGCTGAATGG - Intergenic
1139631402 16:68234088-68234110 CAGTTCTCACAGCTGGTGAACGG - Exonic
1141194017 16:81846088-81846110 CACTCCTAGCAGCTGGGAAATGG - Intronic
1141855688 16:86679872-86679894 CAGTCATAGCAGAAGGTGAAGGG - Intergenic
1143016782 17:3895054-3895076 GTGTCCTAGGAGCTGCTGGAAGG + Intergenic
1144853053 17:18253753-18253775 CTGCCCTGGCACCTGGTGTATGG - Intronic
1150494927 17:65600119-65600141 CTTTCCTGGGAGCTGCTGAATGG + Intronic
1151393547 17:73804015-73804037 CTGGCCAGGCAGCTGGGGAATGG - Intergenic
1151821052 17:76497157-76497179 CTGTGCCAGCAGGTGGTGCAGGG - Intronic
1152023792 17:77795936-77795958 CTGTCCTGACAGCCGGTGAGAGG - Intergenic
1156242576 18:35267904-35267926 CAGTCCTAGGAGCTGCGGAAGGG + Intronic
1156372481 18:36483952-36483974 GTGTCCCCACAGCTGGTGAATGG - Intronic
1158103085 18:53853032-53853054 CTATCCTGGCAGCTGGGGGATGG - Intergenic
1158511139 18:58091698-58091720 ATGTTCTAGCAGCTAGTAAAAGG + Intronic
1159985162 18:74833204-74833226 CTCTCTTAGCAGCTGTTGCAGGG + Intronic
1160695988 19:484776-484798 CTGACCCAGCAGGTCGTGAAGGG + Intergenic
1162121904 19:8475607-8475629 TTGTTCTAGAAGCTGGTAAAAGG + Intronic
1164540786 19:29120126-29120148 CTGTCCCAGCCCCTGGTGCATGG - Intergenic
1164670416 19:30069195-30069217 CTTGCCTGGCAGCTGGTGAGGGG - Intergenic
1165279247 19:34782650-34782672 CTGTCCTCACAGCTGGAGCATGG - Intergenic
1165851046 19:38850492-38850514 CAGTCCTACCATCTGGTGAGAGG - Intronic
1166060093 19:40320680-40320702 CTGTCCTAGGAGCTGGTAGCAGG - Exonic
1166566302 19:43767532-43767554 CAGTCCAAGTAGCTGGTGAGGGG - Exonic
1168110985 19:54191206-54191228 CGGGCCCAGCAGGTGGTGAACGG + Intronic
925027289 2:620133-620155 CTGTCCAAGCAGGAGCTGAAGGG - Intergenic
925990742 2:9252169-9252191 CAGTCCTAGCAGCTGGTGTCAGG - Intronic
926787359 2:16531319-16531341 CTGTCCTGCCTGCTGGTGAAAGG + Intergenic
926919810 2:17929336-17929358 CAGTCCTGGCAGCAGGTGAAAGG + Intronic
930249841 2:49022850-49022872 CTGTCCTAGAAGATGAGGAAAGG - Intronic
931071217 2:58652437-58652459 CTCTTCTAGCAGCTGGGGGATGG + Intergenic
933698653 2:85238566-85238588 CTGTCCTAGGAGCTGAGGATGGG + Intronic
934664223 2:96158621-96158643 CTGTCCCAGCACCTGCTGCATGG - Intergenic
936636098 2:114260365-114260387 CTGACCAAGCAGCTGAGGAATGG - Intergenic
939432494 2:142129933-142129955 TTCTCCAAGCAGCTGGTGAATGG - Intronic
943702656 2:191003616-191003638 CAGTCATAGCAGCAGGTGAAGGG - Intronic
944170913 2:196776505-196776527 CTGGCCCAGCTGCTGCTGAAGGG + Exonic
946638960 2:221762708-221762730 CTGTCCCAGGGGCTGATGAAAGG + Intergenic
947161238 2:227217097-227217119 CAGTCATGGCAGATGGTGAAAGG + Intronic
947851278 2:233290563-233290585 CTTACCTGCCAGCTGGTGAAGGG - Intronic
947935041 2:233997429-233997451 CAGTCCCCACAGCTGGTGAATGG - Intronic
948370235 2:237484266-237484288 GTGTCCTGTCAGCTGGTGCATGG - Intergenic
948751504 2:240136041-240136063 TTCTCCGAGCACCTGGTGAAAGG - Intronic
948883239 2:240870838-240870860 CCATCCTAGCATCTGGTGAGCGG + Intronic
949010774 2:241677138-241677160 CTGTCCCAGAAGCTTGAGAAGGG - Intronic
1170047543 20:12101219-12101241 CTCTCATAGCAGCTGGGGAATGG + Intergenic
1171078129 20:22149731-22149753 CTGTCATAGCATCTGGTGTCTGG - Intergenic
1171487072 20:25493048-25493070 CTGTCCTGGAACCTGGTGGAGGG - Intronic
1173806035 20:45925898-45925920 AGGTCCTGGCAGCTGGGGAAGGG - Intergenic
1175169052 20:57067158-57067180 CAGTCCTGGCAGAAGGTGAAGGG - Intergenic
1181752235 22:24996838-24996860 CTGTCATAGCAGCTGGGGGATGG + Intronic
1181803902 22:25363798-25363820 CTTCCCTAGCAGCTGGTCCAGGG - Intronic
1183265570 22:36823202-36823224 CTGGCCTCCCAGCTGGTGGAGGG + Intergenic
1183514907 22:38259542-38259564 CTGCCCTTGCAGATGGCGAAAGG + Intronic
1184170836 22:42758869-42758891 CTGTGATAACAGCTGCTGAATGG - Intergenic
950686259 3:14620648-14620670 GTGTCCTAGCAACTGGAAAAGGG - Intergenic
953682515 3:45050592-45050614 CTGTCATGGCAGAAGGTGAAGGG - Intergenic
954739020 3:52732012-52732034 CAATCATAGCAGATGGTGAAGGG - Intronic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
957792539 3:84959257-84959279 CTGCCCGAGCAGGTGGTGCAGGG - Intronic
958177995 3:90021606-90021628 CAATCCTAGCAGCTGGGGGATGG + Intergenic
958685535 3:97387904-97387926 CAGTCATAGCAGAAGGTGAAGGG + Intronic
961399851 3:126631811-126631833 TTGTCATAGCAACGGGTGAAAGG - Intronic
961639135 3:128353904-128353926 CTTTCCCAGCAGCAGGTGAGCGG - Intronic
961642323 3:128372362-128372384 CTGCCATGGCAGCTGGTCAAGGG + Intronic
962317361 3:134367217-134367239 GTGTGCAAGGAGCTGGTGAATGG + Intronic
962360608 3:134739903-134739925 CTGTCATAGCAGGAGGTGATGGG - Intronic
962746644 3:138401992-138402014 CTGTCCTGGCCGCTGGAGGAGGG - Intronic
963779838 3:149476016-149476038 CTCTGGGAGCAGCTGGTGAAGGG + Intronic
963785978 3:149534829-149534851 CTTTCCTAGCAGCTGGAGGACGG + Intronic
963932735 3:151020986-151021008 CTGTCCTTGCTCCTGGTGGATGG - Intergenic
965259245 3:166459108-166459130 CTGTAATAGCACCTGGTTAAAGG + Intergenic
965351416 3:167616165-167616187 CTATCCTTGCAGCTGGTAAAGGG + Intronic
965398410 3:168188768-168188790 CTGTCTTAGGAGCTGGGGTAAGG + Intergenic
968285913 3:197508660-197508682 CAGACCTAGCAGCTTGTGACAGG + Intergenic
969338831 4:6527902-6527924 CTGTCCCAGGAGCTGGGGAAGGG + Intronic
971121933 4:23714195-23714217 CTCTGCTACCAGCTGGTGAGTGG + Intergenic
972148865 4:36064463-36064485 CTGTCCCTGCAGGTAGTGAATGG + Intronic
972165746 4:36281928-36281950 GTGCTCCAGCAGCTGGTGAAGGG - Intronic
975498201 4:75057503-75057525 CTGTCCCACCAGCTGGATAAAGG - Intergenic
976302689 4:83530243-83530265 CAGTCCTAGCAGGTCATGAAAGG + Intergenic
984996745 4:185439338-185439360 ATGTCCTACAAGCTGGAGAAAGG + Intronic
985502073 5:254570-254592 CTGGCCTTGCTGATGGTGAACGG + Intronic
991510147 5:67367074-67367096 CTCTCATAGCACCTGGAGAAAGG - Intergenic
994108462 5:95973417-95973439 TTGTCCTTCCAGCTGCTGAATGG + Intergenic
995380526 5:111527378-111527400 CTGTGGTAGCAGCAGATGAATGG - Intergenic
995527156 5:113059269-113059291 CTGTCCTGGAAGCAGGAGAAGGG - Intronic
999085207 5:148882181-148882203 GCGTCCAGGCAGCTGGTGAAGGG - Intergenic
1001559608 5:172660430-172660452 ATGTCCTTGCAGCTGTTGACGGG + Intronic
1002195431 5:177498368-177498390 CTGTCCTAGGAGGAGGTGATGGG - Intergenic
1002356022 5:178629442-178629464 GTGTCCAAGCAGCTAGTCAAAGG + Intronic
1002840532 6:901459-901481 GTGTGCTAGGAGCTGGAGAAAGG - Intergenic
1003756654 6:9128511-9128533 CAATCCTAGCAGAAGGTGAAGGG - Intergenic
1007593592 6:43038082-43038104 CTGTCCTAGCAGCTGGTGGTTGG - Intronic
1007867528 6:44989384-44989406 CTGACCTGTCAGCAGGTGAATGG - Intronic
1007936460 6:45736975-45736997 CAGTCCTTGCGGCTGGTGAGGGG + Intergenic
1008260856 6:49365581-49365603 CAGTCATAGCAGAAGGTGAAGGG + Intergenic
1008972563 6:57386644-57386666 CTGTCCTGACAGCTGTGGAAAGG + Intronic
1009161471 6:60288192-60288214 CTGTCCTGACAGCTGTGGAAAGG + Intergenic
1009759090 6:67980340-67980362 TTGTCCTAGAAGGTAGTGAAGGG - Intergenic
1011010334 6:82696261-82696283 CTTTCCTAGCATCTGATGAAAGG - Intergenic
1012146272 6:95686970-95686992 CTTTCCTAGCAGCTGGTCCTGGG + Intergenic
1013103812 6:107009735-107009757 CTGTCCTCCCATCTGGGGAAGGG - Intergenic
1015417793 6:132969407-132969429 CTGTCTTAGCATCTGGTGGTTGG + Intergenic
1019506302 7:1393178-1393200 CTGTCCTTGCAGCTGTTTTAGGG + Intergenic
1020001250 7:4757206-4757228 CTTTCCTAACAGCTGGAGGACGG - Intronic
1022951736 7:35345782-35345804 TTATCCTAGCAGCTAGGGAATGG - Intergenic
1023372687 7:39528074-39528096 CTGTTCTTGCATCTGGTGCAAGG - Intergenic
1023927253 7:44678500-44678522 CTGTCCTGGCATCTCATGAAGGG - Intronic
1025753373 7:64312300-64312322 CTGTGCTATCAGGTGGTGATGGG + Intronic
1029916848 7:104218941-104218963 CTCTCCTAGCTTCTGGTGGAGGG - Intergenic
1030684003 7:112464802-112464824 CTGTCCGCTCAGCTGGGGAATGG - Intronic
1031158162 7:118135319-118135341 CTGCTCTAGCAGTTGCTGAAAGG + Intergenic
1031441825 7:121803966-121803988 CTGTCTTAGGAGCTCCTGAATGG + Intergenic
1034338399 7:150337800-150337822 CTGTCCTTGCAGCATGTGGAGGG - Exonic
1034451923 7:151141760-151141782 GTGGCCTTGCAGCTGGGGAAGGG + Intronic
1038321080 8:26528140-26528162 CTGTTCTAGCAGCTGATGCCAGG - Intronic
1038439659 8:27562549-27562571 CTTGCCTAACAGCTGGTGCAAGG - Intergenic
1039806679 8:41005891-41005913 CTTGCCTAGCCCCTGGTGAAAGG + Intergenic
1040884960 8:52251743-52251765 GCTGCCTAGCAGCTGGTGAAAGG - Intronic
1041644068 8:60233618-60233640 CTGTTGTTGCAGCTGGAGAAGGG - Intronic
1042203715 8:66307125-66307147 CCTTCCTTGCAGCTGGTGAATGG + Intergenic
1042374611 8:68035757-68035779 CTGTGGTAGAAGATGGTGAAAGG + Intronic
1042509059 8:69592226-69592248 GTGTCCTAGAAACTGGAGAATGG + Intronic
1043204556 8:77420626-77420648 CATTCCTAGCAGCTGGAGGATGG + Intergenic
1044283775 8:90387053-90387075 CAATTCTAGCATCTGGTGAATGG + Intergenic
1046817145 8:118597232-118597254 CTGTCCTATCAGCTGCTGTTTGG + Intronic
1046932491 8:119855620-119855642 CTGTGCCAGCAGCTGGAGGATGG - Exonic
1046981026 8:120336557-120336579 ATGTTCTGGCAGCTGGGGAATGG - Intronic
1047849862 8:128845069-128845091 CTGGCCTAGTACCTGGTGTAAGG + Intergenic
1048258178 8:132922193-132922215 CTGTTATAGCAGCTTGTGAGAGG + Intronic
1048740593 8:137554805-137554827 CTTCCCTAGCTGCTGGTGATTGG - Intergenic
1049312468 8:141940483-141940505 CTGTCAGAGCAGCTGGAGAGGGG - Intergenic
1049566826 8:143344608-143344630 CTGTCCCTGTAGCTGGGGAATGG - Intronic
1049871645 8:144983428-144983450 CAATCATAGCAGCAGGTGAAGGG - Intergenic
1050612147 9:7364046-7364068 CTGTGCTAACAGAAGGTGAAAGG + Intergenic
1054723826 9:68630264-68630286 CTATCATAGCATCTGGTGATGGG + Intergenic
1056054180 9:82803580-82803602 CAGTCATAGCAGAAGGTGAAGGG - Intergenic
1061001937 9:127907486-127907508 CTGTCCCAGAAGCTGTTGACTGG - Intergenic
1061913547 9:133737679-133737701 CTGACCAGGCAGGTGGTGAAGGG - Intronic
1062108943 9:134771500-134771522 CTATCCTAGCAGCAAGTGAGTGG - Intronic
1186061987 X:5719040-5719062 CTGAGCTAGCAGTGGGTGAATGG - Intergenic
1189667514 X:43372772-43372794 CATTCATAGCAGCTGGAGAATGG - Intergenic
1192247284 X:69384221-69384243 CTGTCCTTCCTGCTGGTGAGGGG - Intergenic
1194063498 X:89234155-89234177 CTGTTCTAGGTGCTGGTGATTGG - Intergenic
1194244897 X:91499109-91499131 CTGTGCTAGGAGCTTGGGAATGG - Intergenic
1195458210 X:105093454-105093476 GTGTGCTAGAAGCTGGAGAAGGG + Intronic
1197356157 X:125439143-125439165 CTGTCCTAACAGCAGGAAAATGG - Intergenic
1200291538 X:154879893-154879915 CAGTCCCAGCAGCAGGTAAAGGG - Intronic
1200563873 Y:4740419-4740441 CTGTGCTAGGAGCTTGGGAATGG - Intergenic
1200829338 Y:7675701-7675723 TTCTCATAGCAGCAGGTGAAGGG - Intergenic
1201059558 Y:10033882-10033904 TTCTCATAGCAGCTGGTGAAGGG - Intergenic
1202160994 Y:21936812-21936834 TTCTCATAGCAGCAGGTGAAGGG - Intergenic
1202187282 Y:22198705-22198727 TTCTCATAGCAGCAGGTGAAGGG + Intergenic
1202204078 Y:22387691-22387713 TTCTCATAGCAGCAGGTGAAGGG - Intronic
1202230362 Y:22649561-22649583 TTCTCATAGCAGCAGGTGAAGGG + Intergenic
1202312794 Y:23546604-23546626 TTCTCATAGCAGCAGGTGAAGGG - Intergenic
1202558008 Y:26123990-26124012 TTCTCATAGCAGCAGGTGAAGGG + Intergenic