ID: 1120529454

View in Genome Browser
Species Human (GRCh38)
Location 14:85614558-85614580
Sequence CCTGATAGGGAGCGGCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 241}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120529448_1120529454 -10 Left 1120529448 14:85614545-85614567 CCTGAAAGCAATTCCTGATAGGG 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1120529454 14:85614558-85614580 CCTGATAGGGAGCGGCTGGGTGG 0: 1
1: 0
2: 0
3: 11
4: 241
1120529443_1120529454 23 Left 1120529443 14:85614512-85614534 CCCGGAAGAGAGAAGGACCAGTT 0: 1
1: 0
2: 1
3: 19
4: 290
Right 1120529454 14:85614558-85614580 CCTGATAGGGAGCGGCTGGGTGG 0: 1
1: 0
2: 0
3: 11
4: 241
1120529446_1120529454 -9 Left 1120529446 14:85614544-85614566 CCCTGAAAGCAATTCCTGATAGG 0: 1
1: 0
2: 1
3: 16
4: 159
Right 1120529454 14:85614558-85614580 CCTGATAGGGAGCGGCTGGGTGG 0: 1
1: 0
2: 0
3: 11
4: 241
1120529444_1120529454 22 Left 1120529444 14:85614513-85614535 CCGGAAGAGAGAAGGACCAGTTG 0: 1
1: 0
2: 0
3: 24
4: 200
Right 1120529454 14:85614558-85614580 CCTGATAGGGAGCGGCTGGGTGG 0: 1
1: 0
2: 0
3: 11
4: 241
1120529445_1120529454 6 Left 1120529445 14:85614529-85614551 CCAGTTGTTTCAATTCCCTGAAA 0: 1
1: 0
2: 0
3: 19
4: 273
Right 1120529454 14:85614558-85614580 CCTGATAGGGAGCGGCTGGGTGG 0: 1
1: 0
2: 0
3: 11
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120529454 Original CRISPR CCTGATAGGGAGCGGCTGGG TGG Intronic
900171788 1:1272981-1273003 CCAGATAGGAAGCGGCTGAAAGG - Intronic
900489945 1:2942827-2942849 CCTGACAGGAAGAGGCTGGTCGG + Intergenic
900643532 1:3698491-3698513 CCTGGAAGGGAGGGGCTGGTGGG + Intronic
901656127 1:10770712-10770734 ACTGATGGGGTGGGGCTGGGAGG - Intronic
901660935 1:10797234-10797256 CCTTACATGGAGGGGCTGGGGGG + Intergenic
901718439 1:11175724-11175746 CCTGCTAGGGAGAGCCTGAGAGG - Intronic
902134756 1:14295380-14295402 CATGAGAGGGAGAAGCTGGGAGG - Intergenic
902183804 1:14710384-14710406 TCTGAGAGGGAGCCTCTGGGAGG - Intronic
903868231 1:26413292-26413314 CCAGATAGGGAGGGGCTGAGGGG + Intronic
904495201 1:30882553-30882575 CCTGATGGGGTGCTCCTGGGAGG - Intronic
905243919 1:36599205-36599227 CCTGATGTGGAGCATCTGGGAGG - Intergenic
906936945 1:50222595-50222617 CTTGATAGGGAGCTACTTGGAGG + Intergenic
907527250 1:55061040-55061062 CTGCATAGGGAGGGGCTGGGGGG + Intronic
907735899 1:57111637-57111659 TGTGATAGGGAGTGACTGGGAGG - Intronic
907811707 1:57877376-57877398 CCAGAGAGGGAGCTGCAGGGTGG - Intronic
908452493 1:64269704-64269726 CCTGTAAGGGAGCAGCAGGGAGG - Intergenic
908780358 1:67685205-67685227 GCTGGTAGGCAGTGGCTGGGAGG + Exonic
910251148 1:85200782-85200804 CCTCAGAGGGAGCCGCGGGGAGG - Exonic
915162885 1:153932426-153932448 CCTGATAGGGAGCCTCCCGGCGG - Exonic
915342115 1:155182232-155182254 CTTGCTAGGGTGGGGCTGGGAGG + Intronic
920292959 1:204936782-204936804 CATGATAGGAAGCGGCTGCAGGG - Intronic
920535250 1:206732883-206732905 CCAGAGTGGGAGAGGCTGGGAGG + Exonic
921167118 1:212515166-212515188 CCCGAGAGGGAGCTGCGGGGTGG + Intergenic
921799085 1:219381112-219381134 CATGAGAGGGACCGGGTGGGAGG + Intergenic
923035743 1:230283925-230283947 CCTGATGGGGACAGCCTGGGAGG + Intergenic
923878242 1:238074694-238074716 CCTGTTAGGGAGGGCCTGGAAGG - Intergenic
1064918318 10:20486991-20487013 CCACACAGGGAGGGGCTGGGAGG + Intergenic
1066758890 10:38736732-38736754 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1066962746 10:42236036-42236058 CCTGGCACGGAGCAGCTGGGCGG + Intergenic
1067274158 10:44819643-44819665 CCTGTTAGAGAAGGGCTGGGAGG - Intergenic
1068357697 10:55931273-55931295 CCTGATAGGAAGAGGCAGTGAGG - Intergenic
1073185434 10:101612743-101612765 CCTGAGGAGGAGTGGCTGGGTGG - Intronic
1075601346 10:123771725-123771747 CATGAAAGGGACCGGGTGGGAGG + Intronic
1076859613 10:133134467-133134489 CCTGTCTGGGAGAGGCTGGGGGG - Intergenic
1076904299 10:133354657-133354679 CCTGAAAGGGGGTGCCTGGGAGG - Intergenic
1077177867 11:1198750-1198772 CCTGGTAGGAAGCGGCCTGGAGG + Intronic
1077538686 11:3136295-3136317 CCTGAAGGCGAGCGTCTGGGAGG - Intronic
1083400389 11:62419242-62419264 CCTGCTCTGGAGCTGCTGGGAGG + Intronic
1083953334 11:65968901-65968923 CCTCATAGGGTGTTGCTGGGAGG - Intronic
1084150686 11:67286619-67286641 CCTGATGGGGAGGGTCTCGGTGG + Intergenic
1084561519 11:69908126-69908148 CCTGACAAGGAGCTCCTGGGAGG + Intergenic
1084868543 11:72080275-72080297 CCTGAGAGGGAGGAGCCGGGGGG - Intronic
1085103615 11:73822823-73822845 AGTGATGGGGAGTGGCTGGGAGG - Intronic
1087868303 11:103261226-103261248 CCTGAGACAGAGCAGCTGGGGGG + Intronic
1090667662 11:128925486-128925508 CATGAAAGGGAGAGGGTGGGAGG - Intergenic
1091230933 11:133987534-133987556 CCTCATCGGGAGAGGCTGGGTGG + Intergenic
1091660653 12:2380820-2380842 CCTGCTTGGGAGTGGGTGGGGGG + Intronic
1094428952 12:30345749-30345771 CCTGATAAGGAGCAACTGGTTGG + Intergenic
1099018924 12:77379489-77379511 CCTGCTAGGGTGAGGATGGGGGG + Intergenic
1102173381 12:110859028-110859050 ACTGATAGGGTGCAGCTGTGGGG - Intronic
1102572661 12:113836492-113836514 CTTGGTGGGGAGGGGCTGGGGGG + Intronic
1105603043 13:21903913-21903935 GCAGAGAGGGAGCGGCTTGGTGG + Intergenic
1106286025 13:28318537-28318559 GCTGGTAGGAAGCAGCTGGGAGG + Intronic
1108378258 13:49833579-49833601 CCAGATAGGGAGCAGGTGTGTGG + Intergenic
1109094561 13:58096524-58096546 CCTGAGAGGGACCCGGTGGGAGG + Intergenic
1109228205 13:59722729-59722751 CCTGTTAGGGAGTGGCAGTGAGG + Intronic
1113627836 13:111859450-111859472 CCTGAGCAGGAGAGGCTGGGGGG - Intergenic
1113921938 13:113918242-113918264 CCTGCTGGGGAGCGGCTCTGTGG + Intergenic
1114297481 14:21342703-21342725 TCTGATTCGGAGCGGCGGGGAGG - Intronic
1114647190 14:24262354-24262376 CCTGTTAGGAAGAGGCAGGGTGG + Exonic
1115464737 14:33702702-33702724 CCTGAAGGGGAGAGGGTGGGAGG + Intronic
1118109137 14:62696373-62696395 CCTGAAAGGAAGAGGCTGAGTGG - Intergenic
1120529454 14:85614558-85614580 CCTGATAGGGAGCGGCTGGGTGG + Intronic
1121614755 14:95306005-95306027 CCTGAGAGAGAGTGCCTGGGTGG - Intronic
1202929611 14_KI270725v1_random:26303-26325 CCTGGCACGGAGCAGCTGGGCGG - Intergenic
1123422686 15:20144920-20144942 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1123442320 15:20301429-20301451 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1123531912 15:21151460-21151482 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1129466460 15:75727037-75727059 CCTGAAAGGGAGTGGCGGGAAGG - Exonic
1130397182 15:83512785-83512807 GCTGATAGGGAGAGGGAGGGAGG - Intronic
1132376189 15:101329824-101329846 CCTGCAAGAGAGTGGCTGGGAGG - Intronic
1132560015 16:589366-589388 CCTCGGAGGGAGCGGCGGGGTGG - Exonic
1132562605 16:604164-604186 GCTGCTAGGGAGCTGCTAGGTGG - Intronic
1134440416 16:14296485-14296507 CTTGACAGGGGGCGGCTGGAAGG - Intergenic
1134880903 16:17744979-17745001 GCTGGGAGGGAGGGGCTGGGTGG + Intergenic
1136537748 16:30910405-30910427 CAGGACAGGGAGCGGGTGGGAGG + Intergenic
1136718897 16:32304121-32304143 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1136723918 16:32342477-32342499 CCTGGCATGGAGCAGCTGGGTGG + Intergenic
1136773019 16:32857837-32857859 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1136837270 16:33510385-33510407 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1136842246 16:33548521-33548543 CCTGGCATGGAGCAGCTGGGTGG + Intergenic
1136862060 16:33710421-33710443 CCTGGCACGGAGCAGCTGGGCGG - Intergenic
1136897596 16:34003682-34003704 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1140132364 16:72174822-72174844 TGTGATAGGGAGCTGGTGGGAGG - Intronic
1140661341 16:77193429-77193451 CCTGAAAGGGAGCCCCTGGTGGG - Exonic
1141553592 16:84822113-84822135 CCTGTTGGGGTGAGGCTGGGAGG + Intronic
1141809332 16:86364377-86364399 CATGATAAGGAGGGGCAGGGAGG + Intergenic
1142117706 16:88368619-88368641 CCTGAGAGGGTGTGGCTGGGAGG + Intergenic
1203002513 16_KI270728v1_random:175288-175310 CCTGGCATGGAGCAGCTGGGTGG - Intergenic
1203007534 16_KI270728v1_random:213650-213672 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1203075444 16_KI270728v1_random:1119947-1119969 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1203123554 16_KI270728v1_random:1558604-1558626 CCTGGCATGGAGCAGCTGGGTGG - Intergenic
1203134118 16_KI270728v1_random:1711694-1711716 CCTGGCATGGAGCAGCTGGGTGG - Intergenic
1203147446 16_KI270728v1_random:1810664-1810686 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1203152411 16_KI270728v1_random:1848818-1848840 CCTGGCATGGAGCAGCTGGGTGG + Intergenic
1142689837 17:1598855-1598877 CATCAAAGGGAGCAGCTGGGAGG - Intronic
1142698429 17:1645825-1645847 CCTGAGAGGGAGGGGGTGGCTGG + Intergenic
1142958099 17:3534989-3535011 CCAGAGAAGGAGGGGCTGGGAGG - Intronic
1143016296 17:3892848-3892870 CCTGCAAGGGAGAGGCGGGGGGG - Intronic
1143016318 17:3892920-3892942 CCAGGTAGGGATCGGCGGGGCGG - Exonic
1143039616 17:4024110-4024132 CCTGAGAGGCAGCGATTGGGAGG - Intronic
1143854045 17:9835289-9835311 CCTAATAGGGAGCAGATGGTGGG + Intronic
1144038164 17:11385730-11385752 CCCAACAGGGAGAGGCTGGGGGG + Intronic
1145031351 17:19507496-19507518 CCTGGCTGGGGGCGGCTGGGCGG - Intronic
1147318385 17:39631917-39631939 CTGGGTAGGGAGAGGCTGGGTGG + Intronic
1147961075 17:44167953-44167975 CCTGACAGGGAACGGTTGTGGGG + Intergenic
1148093875 17:45039230-45039252 CCTGACAGGGAGCTGCTGGCAGG - Intronic
1148790187 17:50168445-50168467 GCTGAGAGGAAGCGGCTGGCAGG - Exonic
1150271745 17:63871277-63871299 CCTGATGGTGACAGGCTGGGTGG + Intergenic
1150275293 17:63894174-63894196 CCTGATGGTGACAGGCTGGGTGG + Intergenic
1150830759 17:68517616-68517638 CCTGAGAGGGACCTGGTGGGAGG - Intronic
1151282350 17:73086151-73086173 CCTGATTGGAAGGGGCTGTGAGG + Intronic
1151835761 17:76581683-76581705 CCTGAGAGGGAGGGGCTGGAAGG - Intronic
1151844267 17:76640266-76640288 CCTGGGAGGGAGGGGCAGGGTGG + Intronic
1152819326 17:82428474-82428496 CCTGATGAGGAAGGGCTGGGGGG + Intronic
1153250747 18:3119159-3119181 CATCATAGGGAGTGGTTGGGTGG - Intronic
1153872680 18:9334920-9334942 GGTGAGTGGGAGCGGCTGGGGGG + Exonic
1154177479 18:12094522-12094544 ACTGGTGGGGAGTGGCTGGGGGG + Intronic
1154415802 18:14174624-14174646 CCTGGCACGGAGCAGCTGGGAGG + Intergenic
1156871962 18:41955466-41955488 CCAGATTGGGGGCGGCTGTGAGG + Intronic
1157582647 18:48782424-48782446 CAGGATGGGGAGCGGGTGGGGGG - Intronic
1159054505 18:63450549-63450571 CCGGACGGGGAGCGGCTGGCCGG + Intergenic
1160809882 19:1008779-1008801 CCAGGTGGGGAGCGGGTGGGCGG + Exonic
1160982834 19:1824026-1824048 CCTGATAAGGCACGGGTGGGCGG + Intronic
1161249271 19:3271462-3271484 CCTCTGAGGGTGCGGCTGGGCGG + Intronic
1161812473 19:6478705-6478727 TCTGAGAGGGAGGGGTTGGGAGG + Intronic
1162136354 19:8557792-8557814 TGTGAAAGGGAGAGGCTGGGAGG - Intronic
1162736807 19:12751597-12751619 CCTGCCAGTGAGCGACTGGGAGG + Intergenic
1162871746 19:13591637-13591659 CCAGCTAGGGATCGGATGGGTGG - Intronic
1163102703 19:15107678-15107700 CCTGGAAGGAAGGGGCTGGGAGG + Intronic
1163282929 19:16328103-16328125 CCGGAGAGGTAGCGGCAGGGTGG + Intergenic
1165993093 19:39826987-39827009 CCTGGCAGGGAGGGGGTGGGAGG + Exonic
1166225538 19:41392793-41392815 GCTGGTAGGGAGGAGCTGGGGGG + Intronic
1167264757 19:48478047-48478069 CCTGAAAGGGAAGGGGTGGGAGG - Exonic
925070980 2:965968-965990 ACTGAGTGGGAGCAGCTGGGAGG - Intronic
925177149 2:1793826-1793848 CCTGCAAGGGGGCGGCTGGGAGG - Intronic
925827464 2:7863430-7863452 CCTGACATGGAGCGAGTGGGGGG + Intergenic
927490999 2:23520994-23521016 CCTGAGGGGGAGCGGGGGGGGGG - Intronic
929531467 2:42755709-42755731 CCAGAAAGGGAGCGGGTGGCTGG - Exonic
929819268 2:45260303-45260325 CCTGAAAGGAAGAGGCTGGAAGG - Intergenic
933763890 2:85694505-85694527 CCTGAGAGTGCGAGGCTGGGTGG - Intronic
934460505 2:94211863-94211885 CCTGGCACGGAGCAGCTGGGTGG - Intergenic
935815643 2:106843707-106843729 CATGAAAGGAACCGGCTGGGTGG + Exonic
941020873 2:160407360-160407382 CCTCGGAGGGACCGGCTGGGCGG - Intronic
944472730 2:200072294-200072316 CCTGAGAGGGACCTGATGGGAGG - Intergenic
945132795 2:206592248-206592270 CTGGCTAGGGAGTGGCTGGGAGG - Intronic
947534129 2:230930133-230930155 CTGGACAGGGAGCTGCTGGGAGG - Intronic
1173733780 20:45345763-45345785 CCTGAGAGGGAGTGGCAGGAAGG + Intronic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1174392532 20:50226754-50226776 CCTCCTAGGGAGCAGGTGGGTGG + Intergenic
1174723909 20:52841257-52841279 TGTGATAGGGAGTGGCTGGCTGG - Intergenic
1175121773 20:56721404-56721426 CCTGTGAGGGAGGGGCAGGGAGG + Intergenic
1175271449 20:57736868-57736890 CCAGAGAGGGAGCTGCTGTGGGG - Intergenic
1175870756 20:62208398-62208420 CCTGGTAGGGGGCGGCAGGCTGG - Intergenic
1175943943 20:62550207-62550229 CCTGTCAGGGAGGGGCCGGGAGG + Intergenic
1176591633 21:8654902-8654924 CCTGGCACGGAGCAGCTGGGTGG - Intergenic
1176857538 21:13984680-13984702 CCTGGCACGGAGCAGCTGGGAGG - Intergenic
1178894302 21:36545998-36546020 CCTGAAAGGCAGCTGTTGGGCGG - Intronic
1179150056 21:38802189-38802211 CCTGCTAGGGAATGGCTGGGCGG + Intergenic
1179563884 21:42234561-42234583 CCTGGGAGGGAACGTCTGGGTGG - Intronic
1180158587 21:45989334-45989356 CCTGCCAGGGAGGGGCTGGGTGG + Intronic
1180274481 22:10632014-10632036 CCTGGCACGGAGCAGCTGGGTGG - Intergenic
1180548970 22:16526991-16527013 CCTGGCACGGAGCAGCTGGGCGG - Intergenic
1181179475 22:21056751-21056773 CCTGGGAGGGAAAGGCTGGGAGG - Intronic
1181875846 22:25940202-25940224 CATGAGAGGGAACTGCTGGGAGG + Intronic
1183282113 22:36937597-36937619 TCAGGTAGGGAGCGGCTGTGGGG - Exonic
1183319289 22:37155364-37155386 TATGATGGGGAGTGGCTGGGGGG - Intronic
1183975148 22:41507716-41507738 ACTGAGAGGGAGAGGCAGGGCGG + Intronic
1184040446 22:41940025-41940047 CCTGGTGGGGAGCTGCTGGAGGG - Intronic
1184949108 22:47827386-47827408 CCTGTTGGGGAGGGGCTTGGTGG + Intergenic
1185043340 22:48516847-48516869 CTTGATGGGGAGGGGCTGTGGGG + Intronic
949797020 3:7862577-7862599 CCTTAGAGGGAGCGACTGGCTGG + Intergenic
950903056 3:16513953-16513975 CTTGATTAGGAGGGGCTGGGAGG - Intronic
951068867 3:18301895-18301917 CATGAGAGGGAGCTGGTGGGAGG + Intronic
952970823 3:38649383-38649405 TCGGGGAGGGAGCGGCTGGGCGG + Intronic
953412670 3:42698993-42699015 GCTGGCAGGGAGAGGCTGGGTGG + Intronic
953686632 3:45083104-45083126 CCTGCTTGGAAGGGGCTGGGAGG + Exonic
954201800 3:49027775-49027797 CCGGATGGGGAGCCGCTTGGTGG - Exonic
957215802 3:77317835-77317857 GCTGCTAGGGGGCTGCTGGGGGG + Intronic
960952133 3:123006208-123006230 CCTGAGAGGTGGCTGCTGGGTGG + Intronic
961523870 3:127484260-127484282 TCTGATAGGGAGCGGTTTGGGGG - Intergenic
962242818 3:133765586-133765608 AGTGATGGGGAGAGGCTGGGAGG - Intronic
962350123 3:134650534-134650556 CCCGTTAGGGAGTGGCTGGGAGG + Intronic
964183366 3:153913750-153913772 CCTGATATGGAGCTCCTTGGGGG + Intergenic
966451341 3:180066329-180066351 CATGATCTGGAGCAGCTGGGTGG + Intergenic
970475233 4:16415462-16415484 CCTGATAGGGGCCTGGTGGGAGG + Intergenic
983824992 4:172248665-172248687 CCTGAGAGGGATCCGGTGGGAGG + Intronic
985133891 4:186766266-186766288 CCTGTTAGGGAGCAGCTAGCAGG + Intergenic
985508465 5:298640-298662 GCTGAGTGGGAGCAGCTGGGGGG - Intronic
985508541 5:298913-298935 GCTGAGGGGGAGCAGCTGGGGGG - Intronic
985739525 5:1606847-1606869 GCTGAGGGGGAGCAGCTGGGGGG + Intergenic
990235053 5:53758354-53758376 CATGAGAGAGAGAGGCTGGGGGG - Intergenic
990327450 5:54692368-54692390 CCTGTTAGGGAGGGGCCTGGTGG - Intergenic
991452746 5:66770397-66770419 CCTGACAGAGAGCCACTGGGAGG - Intronic
995870348 5:116737804-116737826 CCTGAAGGGGAGGGCCTGGGTGG + Intergenic
999561059 5:152803433-152803455 CCTGAGAGGGACCTGGTGGGAGG - Intergenic
1001860588 5:175051353-175051375 CATGGTAGGGAGCTGGTGGGAGG + Intergenic
1002314312 5:178333486-178333508 CATGAAAGGGCGTGGCTGGGTGG - Intronic
1005969539 6:30750461-30750483 CCTGATATGGAGAGGGAGGGAGG - Intergenic
1006389290 6:33749043-33749065 CCTGATAGGGAGAGGAGAGGTGG - Intergenic
1013127932 6:107203310-107203332 TCTGATAGGGAGAGGCTGACAGG - Intronic
1015625360 6:135176018-135176040 ACTGAGAGGTAGAGGCTGGGTGG - Intergenic
1016714022 6:147203821-147203843 GGCGATGGGGAGCGGCTGGGCGG + Intergenic
1017721393 6:157245731-157245753 CCTGATTGGGGACGGTTGGGGGG + Intergenic
1018920262 6:168167693-168167715 CCTGACAGGTGGAGGCTGGGTGG - Intergenic
1020759123 7:12246171-12246193 CCTGTAAGGGTGGGGCTGGGAGG + Intergenic
1021489552 7:21203799-21203821 CTTGAGAGGCAGCAGCTGGGAGG - Intergenic
1022413187 7:30155182-30155204 CCTGACAGGGAGTGGCTGCCTGG - Intronic
1024005854 7:45224541-45224563 CCTGAGAGGGTGTGGCAGGGAGG + Intergenic
1024960535 7:54970093-54970115 CCTGATAGAGATTGGCTTGGAGG - Intergenic
1026829213 7:73600910-73600932 CCCGGAAGGGAGCGGGTGGGCGG - Intronic
1029550688 7:101235731-101235753 CCCCAGAGGGAGTGGCTGGGAGG - Intronic
1031287155 7:119885180-119885202 CCTGAGAGGGACCTGGTGGGAGG - Intergenic
1032508868 7:132456012-132456034 CCTGACAGGGCGCCGGTGGGAGG + Intronic
1033905332 7:146194512-146194534 CCTGACAGGGACCTGGTGGGAGG - Intronic
1034235984 7:149569897-149569919 CCCGCTAGGGAGTGGCTGGCGGG - Intergenic
1034469636 7:151248404-151248426 GCTGATCGGGAGGGGCCGGGAGG - Intronic
1034905556 7:154941602-154941624 TCAGAGATGGAGCGGCTGGGCGG + Intronic
1035098679 7:156378584-156378606 GCTGCTATGGAGGGGCTGGGTGG + Intergenic
1035259084 7:157650260-157650282 CCTGATGGGGAGCCCCTGCGGGG - Intronic
1035441860 7:158908733-158908755 CCTGAGCCGGAGAGGCTGGGCGG + Intronic
1035826725 8:2653089-2653111 CCTGGGAGGGGACGGCTGGGAGG - Intergenic
1038250847 8:25902962-25902984 CCTGGTAGGCAGAGGCTGAGTGG + Intronic
1039057929 8:33551278-33551300 CCTGATAGGAAGAGGCAAGGAGG - Intronic
1045884553 8:107079954-107079976 CCTGAGAGGGACCTGGTGGGAGG - Intergenic
1047687114 8:127315867-127315889 CCCGGGAGGCAGCGGCTGGGAGG + Intergenic
1049473483 8:142786562-142786584 CCTTATAGGCACGGGCTGGGCGG + Exonic
1049865682 8:144934036-144934058 CCAGACAGGGAGAGGCAGGGAGG - Intronic
1050579254 9:7033574-7033596 CCTGTTAGGGAACTGCTGAGTGG + Intronic
1052860474 9:33435015-33435037 TCTGTTTGGGAGAGGCTGGGGGG - Intergenic
1053691003 9:40587560-40587582 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1054273802 9:63049931-63049953 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1054302263 9:63388531-63388553 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1054401038 9:64715037-64715059 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1054434644 9:65199351-65199373 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1054495745 9:65822330-65822352 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1056163760 9:83922564-83922586 CCTGATAGGGCCGGGCAGGGTGG - Intergenic
1056783368 9:89568521-89568543 CATGAGAGGGATCTGCTGGGAGG + Intergenic
1057263133 9:93597437-93597459 CCTGACAGAGAGCAGGTGGGAGG - Intronic
1061306647 9:129736376-129736398 CCTGCTGGGGAGCGGCTGCCTGG - Intergenic
1061402920 9:130378285-130378307 GCTGGGAGGGAGAGGCTGGGAGG + Intronic
1061614241 9:131769014-131769036 CCTGAAAGGGAACGGCAGGAGGG + Intergenic
1062404580 9:136389251-136389273 TCTGAAAGTGAGCTGCTGGGTGG + Intronic
1062404588 9:136389316-136389338 TCTGAAAGTGAGCTGCTGGGTGG + Intronic
1062404598 9:136389381-136389403 TCTGAAAGTGAGCTGCTGGGTGG + Intronic
1203621660 Un_KI270749v1:133666-133688 CCTGGCACGGAGCAGCTGGGCGG - Intergenic
1187350818 X:18515261-18515283 CTTGATAGAGAGAGGCTGGAGGG + Intronic
1188985123 X:36762228-36762250 CCTGATAGGCAGTGCCTGGGTGG - Intergenic
1190431095 X:50378559-50378581 CCAGGTAGGCAGGGGCTGGGTGG - Exonic
1196124236 X:112082456-112082478 GCTGTTAGGTAGCGGCTGGCGGG + Exonic
1199862784 X:151816817-151816839 ACTGATAAGGAGAGTCTGGGTGG - Intergenic
1200000621 X:153058079-153058101 CCAGATAGGGAGAGTCTGGAGGG + Exonic
1202583938 Y:26405712-26405734 CCTGGCATGGAGCAGCTGGGCGG + Intergenic