ID: 1120534513

View in Genome Browser
Species Human (GRCh38)
Location 14:85677231-85677253
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120534512_1120534513 -8 Left 1120534512 14:85677216-85677238 CCTTTTTTCTGTATGGGGTGCTT No data
Right 1120534513 14:85677231-85677253 GGGTGCTTAAATTTTAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120534513 Original CRISPR GGGTGCTTAAATTTTAAGAC TGG Intergenic
No off target data available for this crispr