ID: 1120543614

View in Genome Browser
Species Human (GRCh38)
Location 14:85782174-85782196
Sequence GATTCTATTGGAGATGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120543614_1120543617 -9 Left 1120543614 14:85782174-85782196 CCAGCTTCATCTCCAATAGAATC No data
Right 1120543617 14:85782188-85782210 AATAGAATCCTAAGGAGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120543614 Original CRISPR GATTCTATTGGAGATGAAGC TGG (reversed) Intergenic
No off target data available for this crispr