ID: 1120549971

View in Genome Browser
Species Human (GRCh38)
Location 14:85858450-85858472
Sequence GCAGCATCTCATTTTAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120549967_1120549971 -9 Left 1120549967 14:85858436-85858458 CCATTATGTGCCAGGCAGCATCT No data
Right 1120549971 14:85858450-85858472 GCAGCATCTCATTTTAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120549971 Original CRISPR GCAGCATCTCATTTTAAGGG AGG Intergenic
No off target data available for this crispr