ID: 1120551285

View in Genome Browser
Species Human (GRCh38)
Location 14:85876290-85876312
Sequence CAGAATCATGCATTGTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120551285_1120551287 -4 Left 1120551285 14:85876290-85876312 CCTCAAAACAATGCATGATTCTG No data
Right 1120551287 14:85876309-85876331 TCTGTGAGAGTGAAAAGAGAGGG No data
1120551285_1120551286 -5 Left 1120551285 14:85876290-85876312 CCTCAAAACAATGCATGATTCTG No data
Right 1120551286 14:85876308-85876330 TTCTGTGAGAGTGAAAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120551285 Original CRISPR CAGAATCATGCATTGTTTTG AGG (reversed) Intergenic
No off target data available for this crispr