ID: 1120553205

View in Genome Browser
Species Human (GRCh38)
Location 14:85897042-85897064
Sequence GCTTCCTTTTTCATGAGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120553205_1120553206 -6 Left 1120553205 14:85897042-85897064 CCAAGTCTCATGAAAAAGGAAGC No data
Right 1120553206 14:85897059-85897081 GGAAGCACCACTCAGAGATCAGG No data
1120553205_1120553208 22 Left 1120553205 14:85897042-85897064 CCAAGTCTCATGAAAAAGGAAGC No data
Right 1120553208 14:85897087-85897109 GAGCAATAAACAATCATGTATGG No data
1120553205_1120553209 23 Left 1120553205 14:85897042-85897064 CCAAGTCTCATGAAAAAGGAAGC No data
Right 1120553209 14:85897088-85897110 AGCAATAAACAATCATGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120553205 Original CRISPR GCTTCCTTTTTCATGAGACT TGG (reversed) Intergenic
No off target data available for this crispr