ID: 1120553207

View in Genome Browser
Species Human (GRCh38)
Location 14:85897066-85897088
Sequence TCTTGTACCTGATCTCTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120553207_1120553210 10 Left 1120553207 14:85897066-85897088 CCACTCAGAGATCAGGTACAAGA No data
Right 1120553210 14:85897099-85897121 ATCATGTATGGGAAGTAGAGTGG No data
1120553207_1120553209 -1 Left 1120553207 14:85897066-85897088 CCACTCAGAGATCAGGTACAAGA No data
Right 1120553209 14:85897088-85897110 AGCAATAAACAATCATGTATGGG No data
1120553207_1120553208 -2 Left 1120553207 14:85897066-85897088 CCACTCAGAGATCAGGTACAAGA No data
Right 1120553208 14:85897087-85897109 GAGCAATAAACAATCATGTATGG No data
1120553207_1120553212 23 Left 1120553207 14:85897066-85897088 CCACTCAGAGATCAGGTACAAGA No data
Right 1120553212 14:85897112-85897134 AGTAGAGTGGGCTCCAATCAAGG No data
1120553207_1120553211 11 Left 1120553207 14:85897066-85897088 CCACTCAGAGATCAGGTACAAGA No data
Right 1120553211 14:85897100-85897122 TCATGTATGGGAAGTAGAGTGGG No data
1120553207_1120553213 29 Left 1120553207 14:85897066-85897088 CCACTCAGAGATCAGGTACAAGA No data
Right 1120553213 14:85897118-85897140 GTGGGCTCCAATCAAGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120553207 Original CRISPR TCTTGTACCTGATCTCTGAG TGG (reversed) Intergenic
No off target data available for this crispr