ID: 1120553208

View in Genome Browser
Species Human (GRCh38)
Location 14:85897087-85897109
Sequence GAGCAATAAACAATCATGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120553205_1120553208 22 Left 1120553205 14:85897042-85897064 CCAAGTCTCATGAAAAAGGAAGC No data
Right 1120553208 14:85897087-85897109 GAGCAATAAACAATCATGTATGG No data
1120553207_1120553208 -2 Left 1120553207 14:85897066-85897088 CCACTCAGAGATCAGGTACAAGA No data
Right 1120553208 14:85897087-85897109 GAGCAATAAACAATCATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120553208 Original CRISPR GAGCAATAAACAATCATGTA TGG Intergenic
No off target data available for this crispr