ID: 1120554981

View in Genome Browser
Species Human (GRCh38)
Location 14:85918632-85918654
Sequence AAGAGAAAGCGGAAGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120554976_1120554981 12 Left 1120554976 14:85918597-85918619 CCTGAGAGTAGCTTAAAGAATAG No data
Right 1120554981 14:85918632-85918654 AAGAGAAAGCGGAAGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120554981 Original CRISPR AAGAGAAAGCGGAAGGATGG AGG Intergenic
No off target data available for this crispr