ID: 1120555991

View in Genome Browser
Species Human (GRCh38)
Location 14:85930427-85930449
Sequence AGCAGCTCTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120555991_1120555998 23 Left 1120555991 14:85930427-85930449 CCAGTAACAGGCCAAGAGCTGCT No data
Right 1120555998 14:85930473-85930495 GTTATCTGCATAAGATGGCAGGG No data
1120555991_1120555995 -2 Left 1120555991 14:85930427-85930449 CCAGTAACAGGCCAAGAGCTGCT No data
Right 1120555995 14:85930448-85930470 CTTGCTGTCTCTCAAAAGGAGGG No data
1120555991_1120555996 18 Left 1120555991 14:85930427-85930449 CCAGTAACAGGCCAAGAGCTGCT No data
Right 1120555996 14:85930468-85930490 GGGTAGTTATCTGCATAAGATGG No data
1120555991_1120555997 22 Left 1120555991 14:85930427-85930449 CCAGTAACAGGCCAAGAGCTGCT No data
Right 1120555997 14:85930472-85930494 AGTTATCTGCATAAGATGGCAGG No data
1120555991_1120555993 -6 Left 1120555991 14:85930427-85930449 CCAGTAACAGGCCAAGAGCTGCT No data
Right 1120555993 14:85930444-85930466 GCTGCTTGCTGTCTCTCAAAAGG No data
1120555991_1120555994 -3 Left 1120555991 14:85930427-85930449 CCAGTAACAGGCCAAGAGCTGCT No data
Right 1120555994 14:85930447-85930469 GCTTGCTGTCTCTCAAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120555991 Original CRISPR AGCAGCTCTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr