ID: 1120555997

View in Genome Browser
Species Human (GRCh38)
Location 14:85930472-85930494
Sequence AGTTATCTGCATAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120555989_1120555997 29 Left 1120555989 14:85930420-85930442 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 1120555997 14:85930472-85930494 AGTTATCTGCATAAGATGGCAGG No data
1120555992_1120555997 11 Left 1120555992 14:85930438-85930460 CCAAGAGCTGCTTGCTGTCTCTC No data
Right 1120555997 14:85930472-85930494 AGTTATCTGCATAAGATGGCAGG No data
1120555990_1120555997 23 Left 1120555990 14:85930426-85930448 CCCAGTAACAGGCCAAGAGCTGC No data
Right 1120555997 14:85930472-85930494 AGTTATCTGCATAAGATGGCAGG No data
1120555991_1120555997 22 Left 1120555991 14:85930427-85930449 CCAGTAACAGGCCAAGAGCTGCT No data
Right 1120555997 14:85930472-85930494 AGTTATCTGCATAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120555997 Original CRISPR AGTTATCTGCATAAGATGGC AGG Intergenic
No off target data available for this crispr