ID: 1120559387

View in Genome Browser
Species Human (GRCh38)
Location 14:85972297-85972319
Sequence TGTGCTCCTGAATGACTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1120559387_1120559391 4 Left 1120559387 14:85972297-85972319 CCCTGTAGTCATTCAGGAGCACA No data
Right 1120559391 14:85972324-85972346 TCAGTTTCCATGTAGTTGTGGGG 0: 1040
1: 5757
2: 2207
3: 1033
4: 1051
1120559387_1120559389 2 Left 1120559387 14:85972297-85972319 CCCTGTAGTCATTCAGGAGCACA No data
Right 1120559389 14:85972322-85972344 GTTCAGTTTCCATGTAGTTGTGG 0: 62
1: 38
2: 22
3: 32
4: 242
1120559387_1120559390 3 Left 1120559387 14:85972297-85972319 CCCTGTAGTCATTCAGGAGCACA No data
Right 1120559390 14:85972323-85972345 TTCAGTTTCCATGTAGTTGTGGG 0: 17
1: 56
2: 30
3: 60
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1120559387 Original CRISPR TGTGCTCCTGAATGACTACA GGG (reversed) Intergenic
No off target data available for this crispr